Incidental Mutation 'R3622:Olfr1461'
ID268692
Institutional Source Beutler Lab
Gene Symbol Olfr1461
Ensembl Gene ENSMUSG00000045883
Gene Nameolfactory receptor 1461
SynonymsGA_x6K02T2RE5P-3491834-3492772, MOR202-35
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13163000-13168130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13165656 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 214 (M214K)
Ref Sequence ENSEMBL: ENSMUSP00000146358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053772] [ENSMUST00000207113] [ENSMUST00000208489]
Predicted Effect probably benign
Transcript: ENSMUST00000053772
AA Change: M214K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053269
Gene: ENSMUSG00000045883
AA Change: M214K

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 6e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 8e-6 PFAM
Pfam:7tm_1 42 291 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207113
AA Change: M214K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000208489
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Olfr1461
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1461 APN 19 13165371 missense probably damaging 1.00
IGL01370:Olfr1461 APN 19 13165299 missense possibly damaging 0.95
IGL01936:Olfr1461 APN 19 13165403 missense probably damaging 1.00
R0098:Olfr1461 UTSW 19 13165662 missense probably benign 0.12
R0270:Olfr1461 UTSW 19 13165887 missense probably damaging 1.00
R0575:Olfr1461 UTSW 19 13165387 nonsense probably null
R0627:Olfr1461 UTSW 19 13165250 missense probably benign 0.43
R1779:Olfr1461 UTSW 19 13165040 missense probably benign 0.00
R1956:Olfr1461 UTSW 19 13165196 missense probably damaging 1.00
R2446:Olfr1461 UTSW 19 13165447 missense probably benign 0.00
R4485:Olfr1461 UTSW 19 13165491 missense possibly damaging 0.54
R4605:Olfr1461 UTSW 19 13165248 missense probably damaging 1.00
R4757:Olfr1461 UTSW 19 13165913 missense probably benign 0.01
R4816:Olfr1461 UTSW 19 13165124 missense probably benign 0.10
R5038:Olfr1461 UTSW 19 13165591 missense probably benign 0.39
R7026:Olfr1461 UTSW 19 13165415 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCAGTGTGTAAACCCCTAC -3'
(R):5'- GTGTCCATTGCATGTCTAGAGC -3'

Sequencing Primer
(F):5'- GCAGTGTGTAAACCCCTACATTATAC -3'
(R):5'- GTCTAGAGCTTGGCTGCAAATAC -3'
Posted On2015-02-19