Incidental Mutation 'R3623:Itga10'
ID268703
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 96651738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably benign
Transcript: ENSMUST00000029744
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119365
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TACAGGTTGGATAGACCCTGAC -3'
(R):5'- ACTCTCTGTGACTCACCCAG -3'

Sequencing Primer
(F):5'- GGATAGACCCTGACCCTCTC -3'
(R):5'- TCTCTGTGACTCACCCAGGTAGG -3'
Posted On2015-02-19