Incidental Mutation 'R3623:Dffb'
ID268706
Institutional Source Beutler Lab
Gene Symbol Dffb
Ensembl Gene ENSMUSG00000029027
Gene NameDNA fragmentation factor, beta subunit
Synonyms5730477D02Rik, caspase-activated DNase, Didff, CAD, CPAN, DFF40, 40kDa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location153964449-153975126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153965519 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 296 (T296A)
Ref Sequence ENSEMBL: ENSMUSP00000030893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030893] [ENSMUST00000058393] [ENSMUST00000105645] [ENSMUST00000133607] [ENSMUST00000141493] [ENSMUST00000147826]
PDB Structure
NMR STRUCTURE OF THE CAD DOMAIN OF CASPASE-ACTIVATED DNASE [SOLUTION NMR]
NMR STRUCTURE OF THE HETERODIMERIC COMPLEX BETWEEN CAD DOMAINS OF CAD AND ICAD [SOLUTION NMR]
CRYSTAL STRUCTURE OF CASPASE-ACTIVATED DNASE (CAD) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030893
AA Change: T296A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030893
Gene: ENSMUSG00000029027
AA Change: T296A

DomainStartEndE-ValueType
CAD 9 81 2.48e-41 SMART
Pfam:DFF40 103 324 9.4e-97 PFAM
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058393
SMART Domains Protein: ENSMUSP00000054638
Gene: ENSMUSG00000047613

DomainStartEndE-ValueType
Pfam:UPF0688 6 228 9.9e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133524
Predicted Effect probably benign
Transcript: ENSMUST00000133607
Predicted Effect probably benign
Transcript: ENSMUST00000141493
Predicted Effect probably benign
Transcript: ENSMUST00000147826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219093
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and developmentally normal; however, mutant thymocytes and other cell types fail to undergo apoptotic DNA fragmentation in response to dexamethasone or other apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Dffb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Dffb APN 4 153965616 unclassified probably benign
R0243:Dffb UTSW 4 153965378 nonsense probably null
R0244:Dffb UTSW 4 153974615 missense probably benign 0.33
R2483:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3622:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3624:Dffb UTSW 4 153965519 missense probably damaging 1.00
R4562:Dffb UTSW 4 153965456 missense probably damaging 1.00
R4912:Dffb UTSW 4 153965407 unclassified probably benign
R5015:Dffb UTSW 4 153972959 missense possibly damaging 0.84
R5986:Dffb UTSW 4 153965593 missense probably damaging 1.00
R6950:Dffb UTSW 4 153970092 missense probably benign
R7395:Dffb UTSW 4 153969113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACAGGAACACGATGAG -3'
(R):5'- GGTAGACACTGCATCCACAG -3'

Sequencing Primer
(F):5'- ATGAGCACCGGCACTGAC -3'
(R):5'- TGCATCCACAGACAGCGAGTG -3'
Posted On2015-02-19