Incidental Mutation 'R3623:Mdfic'
ID268711
Institutional Source Beutler Lab
Gene Symbol Mdfic
Ensembl Gene ENSMUSG00000041390
Gene NameMyoD family inhibitor domain containing
Synonymsclone 1.5, Kdt1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location15720661-15802169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15770320 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 108 (N108K)
Ref Sequence ENSEMBL: ENSMUSP00000139704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101663] [ENSMUST00000120512] [ENSMUST00000125326] [ENSMUST00000128849] [ENSMUST00000140516] [ENSMUST00000189359] [ENSMUST00000190255]
Predicted Effect probably damaging
Transcript: ENSMUST00000101663
AA Change: N108K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099186
Gene: ENSMUSG00000041390
AA Change: N108K

DomainStartEndE-ValueType
Pfam:MDFI 74 247 7.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120512
AA Change: N108K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113050
Gene: ENSMUSG00000041390
AA Change: N108K

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125326
AA Change: N108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139704
Gene: ENSMUSG00000041390
AA Change: N108K

DomainStartEndE-ValueType
Pfam:MDFI 74 175 6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128849
AA Change: N103K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000140516
Predicted Effect probably damaging
Transcript: ENSMUST00000189359
AA Change: N108K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140208
Gene: ENSMUSG00000041390
AA Change: N108K

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190255
AA Change: N190K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140641
Gene: ENSMUSG00000041390
AA Change: N190K

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:MDFI 156 329 8.8e-73 PFAM
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, which in human have been shown to have different subcellular localization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Mdfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mdfic APN 6 15741074 missense possibly damaging 0.95
IGL02184:Mdfic APN 6 15770367 missense possibly damaging 0.76
IGL03104:Mdfic APN 6 15770320 missense probably damaging 1.00
IGL03177:Mdfic APN 6 15770451 missense probably damaging 1.00
R0521:Mdfic UTSW 6 15799756 missense probably benign 0.07
R1549:Mdfic UTSW 6 15799845 missense probably damaging 1.00
R1613:Mdfic UTSW 6 15799590 intron probably null
R2496:Mdfic UTSW 6 15741042 missense possibly damaging 0.92
R3087:Mdfic UTSW 6 15799669 missense probably damaging 1.00
R3887:Mdfic UTSW 6 15799711 missense probably damaging 1.00
R4736:Mdfic UTSW 6 15741020 missense possibly damaging 0.79
R5704:Mdfic UTSW 6 15770292 missense probably damaging 1.00
R6187:Mdfic UTSW 6 15721197 utr 5 prime probably benign
R6501:Mdfic UTSW 6 15770517 missense possibly damaging 0.48
R6517:Mdfic UTSW 6 15770325 missense probably damaging 1.00
R6521:Mdfic UTSW 6 15729028 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCATCATGGGTTAGATCTCAAGTC -3'
(R):5'- ATGCACATCGATGTCCCACTC -3'

Sequencing Primer
(F):5'- TGAACGTCTGCCTCAACT -3'
(R):5'- GATGTCCCACTCACCTTCGGG -3'
Posted On2015-02-19