Incidental Mutation 'R3623:Olfr653'
ID268729
Institutional Source Beutler Lab
Gene Symbol Olfr653
Ensembl Gene ENSMUSG00000073926
Gene Nameolfactory receptor 653
SynonymsMOR33-1, GA_x6K02T2PBJ9-7206970-7207923
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104577314-104584117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104579942 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 99 (S99P)
Ref Sequence ENSEMBL: ENSMUSP00000149192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098174] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect probably damaging
Transcript: ENSMUST00000098174
AA Change: S99P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095776
Gene: ENSMUSG00000073926
AA Change: S99P

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 2.2e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 179 4.6e-10 PFAM
Pfam:7tm_1 47 298 5.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215585
AA Change: S99P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217466
AA Change: S99P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Olfr653
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Olfr653 APN 7 104579943 missense probably damaging 1.00
I2288:Olfr653 UTSW 7 104580386 missense probably damaging 1.00
PIT4131001:Olfr653 UTSW 7 104580030 missense probably damaging 0.99
R0325:Olfr653 UTSW 7 104580360 missense probably damaging 1.00
R1579:Olfr653 UTSW 7 104580061 nonsense probably null
R1599:Olfr653 UTSW 7 104579648 start codon destroyed probably null
R1956:Olfr653 UTSW 7 104579909 missense probably damaging 1.00
R2134:Olfr653 UTSW 7 104579641 start gained probably benign
R2418:Olfr653 UTSW 7 104579934 missense probably benign 0.00
R2483:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
R4049:Olfr653 UTSW 7 104580368 missense probably benign
R4755:Olfr653 UTSW 7 104580061 nonsense probably null
R4757:Olfr653 UTSW 7 104580197 missense possibly damaging 0.95
R4828:Olfr653 UTSW 7 104579973 missense possibly damaging 0.62
R4842:Olfr653 UTSW 7 104580215 missense probably benign 0.45
R5496:Olfr653 UTSW 7 104580494 missense probably damaging 1.00
R6830:Olfr653 UTSW 7 104580240 missense probably damaging 1.00
R7320:Olfr653 UTSW 7 104580438 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTGGAATCCCTGGGATG -3'
(R):5'- GCATGCCAGGCCAATCTTTC -3'

Sequencing Primer
(F):5'- AATCCCTGGGATGCAGGATC -3'
(R):5'- TCCAATTACAACAGCATTGAGGATGG -3'
Posted On2015-02-19