Incidental Mutation 'R3691:Cfap43'
ID268802
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Namecilia and flagella associated protein 43
Synonyms4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96
MMRRC Submission 040686-MU
Accession Numbers

Genbank: NM_027559

Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R3691 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47737561-47919299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47897073 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 368 (L368F)
Ref Sequence ENSEMBL: ENSMUSP00000093697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095998]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect probably benign
Transcript: ENSMUST00000095998
AA Change: L368F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093697
Gene: ENSMUSG00000044948
AA Change: L368F

DomainStartEndE-ValueType
SCOP:d1eq1a_ 27 82 3e-3 SMART
low complexity region 115 135 N/A INTRINSIC
Mab-21 194 528 4.37e-84 SMART
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Best2 A G 8: 85,011,254 F171L probably benign Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Drosha G A 15: 12,834,638 R276H unknown Het
Efr3b T A 12: 3,982,059 D183V possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epha1 T C 6: 42,361,130 T794A probably damaging Het
Fbxo17 G A 7: 28,737,462 V281I probably damaging Het
Flii T C 11: 60,719,757 Y571C probably benign Het
Flywch1 G A 17: 23,763,212 P6L probably damaging Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fras1 C T 5: 96,781,512 T3925I probably benign Het
Gk5 T C 9: 96,129,096 probably null Het
Gm12588 T G 11: 121,905,925 Q366P possibly damaging Het
Gm3248 A G 14: 5,943,068 I161T probably damaging Het
Gzmg T A 14: 56,157,677 probably benign Het
Lrrc69 A T 4: 14,795,980 N22K possibly damaging Het
Med13l A G 5: 118,721,497 R250G probably benign Het
Mxi1 T C 19: 53,369,631 L73P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Napb T C 2: 148,703,057 probably null Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1123 T C 2: 87,418,170 F39L probably benign Het
Oxct1 A G 15: 4,047,517 M111V probably benign Het
Pcnx4 A G 12: 72,573,719 D771G probably damaging Het
Serpina6 T C 12: 103,654,409 D27G probably benign Het
Tecpr1 A G 5: 144,209,979 F523S probably benign Het
Zan A G 5: 137,420,019 I2939T unknown Het
Zfc3h1 A G 10: 115,420,690 T1522A probably benign Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47830475 missense probably benign 0.08
IGL00325:Cfap43 APN 19 47823188 splice site probably benign
IGL00918:Cfap43 APN 19 47896661 missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01404:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01656:Cfap43 APN 19 47751900 missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47797185 missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47751923 splice site probably benign
IGL02225:Cfap43 APN 19 47812177 missense probably benign 0.00
IGL02308:Cfap43 APN 19 47748024 missense probably benign
IGL02354:Cfap43 APN 19 47897413 nonsense probably null
IGL02361:Cfap43 APN 19 47897413 nonsense probably null
IGL03283:Cfap43 APN 19 47791412 splice site probably benign
3-1:Cfap43 UTSW 19 47751855 missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47815863 missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47897302 missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47797203 splice site probably benign
R0421:Cfap43 UTSW 19 47835575 missense probably benign 0.00
R0433:Cfap43 UTSW 19 47825771 missense probably benign 0.44
R0576:Cfap43 UTSW 19 47797140 missense probably benign 0.00
R0646:Cfap43 UTSW 19 47763676 missense probably benign 0.25
R0740:Cfap43 UTSW 19 47835804 missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47815846 missense probably benign 0.02
R0899:Cfap43 UTSW 19 47747994 missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47835711 missense probably benign 0.03
R1271:Cfap43 UTSW 19 47739744 missense probably benign 0.22
R1271:Cfap43 UTSW 19 47747948 missense probably damaging 0.98
R1371:Cfap43 UTSW 19 47835606 missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47896875 missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47763852 splice site probably null
R1625:Cfap43 UTSW 19 47751088 missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47773114 missense probably benign 0.00
R1690:Cfap43 UTSW 19 47751066 critical splice donor site probably null
R1820:Cfap43 UTSW 19 47897216 missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47813941 missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R1958:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R2110:Cfap43 UTSW 19 47835758 missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47770438 missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47773135 missense probably damaging 0.99
R3765:Cfap43 UTSW 19 47835575 missense probably benign 0.01
R3917:Cfap43 UTSW 19 47897750 missense probably benign 0.00
R3924:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3925:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3947:Cfap43 UTSW 19 47765979 missense probably benign 0.28
R4256:Cfap43 UTSW 19 47782405 missense probably benign 0.06
R4385:Cfap43 UTSW 19 47797129 missense probably benign 0.28
R4395:Cfap43 UTSW 19 47751913 missense probably benign 0.00
R4405:Cfap43 UTSW 19 47739797 missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47748015 missense probably benign 0.02
R4583:Cfap43 UTSW 19 47837216 missense probably null 0.99
R4690:Cfap43 UTSW 19 47747859 missense probably benign 0.45
R4852:Cfap43 UTSW 19 47897111 missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47780394 missense probably benign 0.00
R5192:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47897372 missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47897548 missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47896932 missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47738209 intron probably null
R5644:Cfap43 UTSW 19 47795675 missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47795696 missense probably benign
R5901:Cfap43 UTSW 19 47897099 missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47780271 missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47760896 missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47745574 missense probably benign 0.42
R6817:Cfap43 UTSW 19 47756085 missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47785278 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTAGGTGGTAGTCACTCAGCCC -3'
(R):5'- TGAAGTGGTTTCAGATGGCC -3'

Sequencing Primer
(F):5'- TAGTCACTCAGCCCACTGG -3'
(R):5'- AAGTGGTTTCAGATGGCCCTCAC -3'
Posted On2015-02-19