Incidental Mutation 'R3692:Cic'
ID 268817
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Name capicua transcriptional repressor
Synonyms 1200010B10Rik
MMRRC Submission 040687-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R3692 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 24967129-24993584 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 24988338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1675 (Y1675*)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]
AlphaFold Q924A2
Predicted Effect probably null
Transcript: ENSMUST00000005578
AA Change: Y768*
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: Y768*

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163320
AA Change: Y768*
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: Y768*

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect probably benign
Transcript: ENSMUST00000163901
SMART Domains Protein: ENSMUSP00000127858
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect probably benign
Transcript: ENSMUST00000164820
SMART Domains Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165239
AA Change: Y768*
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: Y768*

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169266
AA Change: Y1675*
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: Y1675*

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T C 5: 121,657,385 (GRCm39) D636G probably damaging Het
Adgrv1 A G 13: 81,672,719 (GRCm39) V2218A possibly damaging Het
Ano5 T A 7: 51,240,327 (GRCm39) Y752N probably damaging Het
Bltp2 A G 11: 78,160,335 (GRCm39) D598G probably damaging Het
Calca T C 7: 114,233,796 (GRCm39) E45G probably damaging Het
Cdk8 C T 5: 146,220,478 (GRCm39) R166* probably null Het
Chsy1 T A 7: 65,821,001 (GRCm39) M412K probably damaging Het
Col1a2 T A 6: 4,510,710 (GRCm39) D53E possibly damaging Het
Dennd6b A G 15: 89,071,030 (GRCm39) probably benign Het
Fut10 T A 8: 31,726,048 (GRCm39) Y268N possibly damaging Het
Glrx3 T C 7: 137,060,846 (GRCm39) probably benign Het
Gucy1b2 T A 14: 62,642,076 (GRCm39) N697I probably damaging Het
Ifi208 T C 1: 173,510,438 (GRCm39) S198P possibly damaging Het
Krt34 A G 11: 99,929,857 (GRCm39) V213A probably damaging Het
Lats2 T C 14: 57,928,998 (GRCm39) N959S probably damaging Het
Mat1a A G 14: 40,843,338 (GRCm39) Y288C probably damaging Het
Mtif2 A T 11: 29,490,718 (GRCm39) H474L probably benign Het
Myh8 A G 11: 67,192,744 (GRCm39) I1512V probably damaging Het
Nkx2-6 T C 14: 69,409,476 (GRCm39) S76P probably benign Het
Noxred1 G A 12: 87,280,240 (GRCm39) R31W probably benign Het
Or14c46 T A 7: 85,918,703 (GRCm39) Q98L probably damaging Het
Or4a69 T A 2: 89,313,240 (GRCm39) M80L probably benign Het
Pcdhb16 C A 18: 37,611,340 (GRCm39) T100K probably benign Het
Pcdhga10 T C 18: 37,881,384 (GRCm39) C382R probably damaging Het
Pdgfra A T 5: 75,349,948 (GRCm39) Y944F possibly damaging Het
Pkhd1 A G 1: 20,625,353 (GRCm39) I741T possibly damaging Het
Ppp1r10 A G 17: 36,241,760 (GRCm39) D845G unknown Het
Rfk C A 19: 17,376,834 (GRCm39) probably null Het
Rgs11 C T 17: 26,423,302 (GRCm39) probably benign Het
Spata31d1b T C 13: 59,865,705 (GRCm39) V951A probably benign Het
St3gal5 T C 6: 72,126,013 (GRCm39) V286A probably benign Het
St7l T C 3: 104,798,870 (GRCm39) M320T probably benign Het
Tnfrsf1b G T 4: 144,954,092 (GRCm39) Q86K probably benign Het
Tox T C 4: 6,697,535 (GRCm39) I423V probably benign Het
Tpbpa T A 13: 61,087,827 (GRCm39) H88L probably benign Het
Vmn1r236 A G 17: 21,507,068 (GRCm39) Y62C probably benign Het
Ythdc1 A G 5: 86,970,526 (GRCm39) I399M probably damaging Het
Zfp948 T G 17: 21,807,838 (GRCm39) D343E probably benign Het
Zswim6 A G 13: 107,863,076 (GRCm39) noncoding transcript Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 24,991,549 (GRCm39) missense probably damaging 1.00
IGL01668:Cic APN 7 24,990,629 (GRCm39) missense possibly damaging 0.47
IGL02229:Cic APN 7 24,990,375 (GRCm39) missense probably damaging 0.96
IGL02506:Cic APN 7 24,990,282 (GRCm39) missense probably benign
IGL02794:Cic APN 7 24,985,069 (GRCm39) missense probably damaging 1.00
IGL03065:Cic APN 7 24,985,246 (GRCm39) splice site probably benign
IGL03304:Cic APN 7 24,984,274 (GRCm39) missense probably damaging 1.00
Capuccino UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
Cassock UTSW 7 24,988,338 (GRCm39) nonsense probably null
Monkey UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R4850_Cic_466 UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
1mM(1):Cic UTSW 7 24,990,214 (GRCm39) splice site probably benign
IGL03046:Cic UTSW 7 24,990,500 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0027:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0027:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0038:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0038:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0063:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0063:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0064:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0064:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0118:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0241:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0241:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0377:Cic UTSW 7 24,985,224 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0800:Cic UTSW 7 24,984,662 (GRCm39) missense probably benign
R1253:Cic UTSW 7 24,990,373 (GRCm39) missense probably damaging 1.00
R1458:Cic UTSW 7 24,979,162 (GRCm39) intron probably benign
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1519:Cic UTSW 7 24,993,235 (GRCm39) critical splice acceptor site probably null
R1586:Cic UTSW 7 24,985,386 (GRCm39) missense probably damaging 1.00
R1824:Cic UTSW 7 24,987,691 (GRCm39) missense probably damaging 1.00
R1908:Cic UTSW 7 24,986,265 (GRCm39) missense probably damaging 1.00
R2045:Cic UTSW 7 24,970,961 (GRCm39) missense possibly damaging 0.53
R2063:Cic UTSW 7 24,972,876 (GRCm39) missense probably damaging 0.98
R2161:Cic UTSW 7 24,987,559 (GRCm39) splice site probably null
R2495:Cic UTSW 7 24,991,201 (GRCm39) splice site probably benign
R2865:Cic UTSW 7 24,972,646 (GRCm39) missense probably damaging 0.96
R3709:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3710:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3872:Cic UTSW 7 24,971,124 (GRCm39) missense possibly damaging 0.92
R3946:Cic UTSW 7 24,971,771 (GRCm39) missense possibly damaging 0.93
R4199:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4426:Cic UTSW 7 24,993,433 (GRCm39) utr 3 prime probably benign
R4502:Cic UTSW 7 24,987,892 (GRCm39) missense probably damaging 1.00
R4585:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4586:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4614:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4664:Cic UTSW 7 24,990,099 (GRCm39) small deletion probably benign
R4688:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4695:Cic UTSW 7 24,973,013 (GRCm39) missense possibly damaging 0.72
R4696:Cic UTSW 7 24,987,908 (GRCm39) missense probably benign
R4746:Cic UTSW 7 24,987,905 (GRCm39) missense probably damaging 1.00
R4758:Cic UTSW 7 24,991,636 (GRCm39) missense possibly damaging 0.62
R4767:Cic UTSW 7 24,971,025 (GRCm39) missense possibly damaging 0.92
R4776:Cic UTSW 7 24,982,308 (GRCm39) missense possibly damaging 0.95
R4820:Cic UTSW 7 24,971,157 (GRCm39) missense possibly damaging 0.92
R4850:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4851:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4922:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R4989:Cic UTSW 7 24,986,535 (GRCm39) missense probably damaging 1.00
R5131:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R5718:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R5801:Cic UTSW 7 24,970,863 (GRCm39) missense possibly damaging 0.93
R5949:Cic UTSW 7 24,971,730 (GRCm39) missense probably damaging 1.00
R6000:Cic UTSW 7 24,971,423 (GRCm39) missense probably benign 0.33
R6246:Cic UTSW 7 24,971,067 (GRCm39) missense probably damaging 1.00
R6283:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R6364:Cic UTSW 7 24,972,248 (GRCm39) missense possibly damaging 0.72
R6481:Cic UTSW 7 24,987,706 (GRCm39) missense possibly damaging 0.56
R6919:Cic UTSW 7 24,971,202 (GRCm39) missense probably benign 0.04
R6920:Cic UTSW 7 24,990,107 (GRCm39) missense probably damaging 1.00
R6995:Cic UTSW 7 24,970,736 (GRCm39) missense possibly damaging 0.53
R7002:Cic UTSW 7 24,971,621 (GRCm39) missense probably damaging 0.99
R7113:Cic UTSW 7 24,972,869 (GRCm39) missense probably benign 0.08
R7560:Cic UTSW 7 24,972,278 (GRCm39) missense probably damaging 0.98
R7680:Cic UTSW 7 24,991,856 (GRCm39) missense probably damaging 0.96
R7698:Cic UTSW 7 24,972,597 (GRCm39) missense possibly damaging 0.72
R7746:Cic UTSW 7 24,988,207 (GRCm39) missense probably damaging 1.00
R7841:Cic UTSW 7 24,985,192 (GRCm39) missense probably damaging 1.00
R7879:Cic UTSW 7 24,984,551 (GRCm39) missense probably benign 0.10
R7916:Cic UTSW 7 24,987,715 (GRCm39) missense probably damaging 0.99
R7920:Cic UTSW 7 24,971,384 (GRCm39) missense probably benign
R8056:Cic UTSW 7 24,990,366 (GRCm39) missense possibly damaging 0.90
R8226:Cic UTSW 7 24,987,213 (GRCm39) missense probably damaging 1.00
R8281:Cic UTSW 7 24,971,249 (GRCm39) missense probably benign
R8847:Cic UTSW 7 24,970,631 (GRCm39) missense probably damaging 0.98
R8991:Cic UTSW 7 24,988,885 (GRCm39) missense probably damaging 1.00
R9083:Cic UTSW 7 24,985,470 (GRCm39) missense probably damaging 0.99
R9140:Cic UTSW 7 24,985,165 (GRCm39) missense probably damaging 0.99
R9200:Cic UTSW 7 24,971,940 (GRCm39) missense probably damaging 0.99
R9208:Cic UTSW 7 24,987,502 (GRCm39) missense probably benign 0.07
R9301:Cic UTSW 7 24,991,117 (GRCm39) missense probably damaging 1.00
R9408:Cic UTSW 7 24,971,414 (GRCm39) missense possibly damaging 0.70
R9569:Cic UTSW 7 24,972,120 (GRCm39) missense possibly damaging 0.85
R9752:Cic UTSW 7 24,971,403 (GRCm39) missense probably damaging 0.96
V7732:Cic UTSW 7 24,991,670 (GRCm39) missense probably benign
Z1176:Cic UTSW 7 24,970,444 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGCTGAGGCATCTTCAAATGAC -3'
(R):5'- GATGTACTGCACCTGTGTGATTC -3'

Sequencing Primer
(F):5'- TCTTCAAATGACATAGCAGGTGCC -3'
(R):5'- ACCTGTGTGATTCCCCCAG -3'
Posted On 2015-02-19