Incidental Mutation 'R3692:Chsy1'
ID268819
Institutional Source Beutler Lab
Gene Symbol Chsy1
Ensembl Gene ENSMUSG00000032640
Gene Namechondroitin sulfate synthase 1
Synonyms
MMRRC Submission 040687-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3692 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66109515-66173798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66171253 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 412 (M412K)
Ref Sequence ENSEMBL: ENSMUSP00000047487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036372]
Predicted Effect probably damaging
Transcript: ENSMUST00000036372
AA Change: M412K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047487
Gene: ENSMUSG00000032640
AA Change: M412K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Fringe 81 307 3.8e-21 PFAM
Pfam:CHGN 237 776 9.8e-197 PFAM
Pfam:Glyco_tranf_2_2 548 751 1.2e-10 PFAM
Pfam:Glyco_transf_7C 674 747 2.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181911
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mice are viable, but display chondrodysplasia, brachydactyly and decreased bone density. Retinal degeneration, impaired motor strength, and hematological abnormalities are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,269,509 D598G probably damaging Het
Adam1a T C 5: 121,519,322 D636G probably damaging Het
Adgrv1 A G 13: 81,524,600 V2218A possibly damaging Het
Ano5 T A 7: 51,590,579 Y752N probably damaging Het
Calca T C 7: 114,634,561 E45G probably damaging Het
Cdk8 C T 5: 146,283,668 R166* probably null Het
Cic T A 7: 25,288,913 Y1675* probably null Het
Col1a2 T A 6: 4,510,710 D53E possibly damaging Het
Dennd6b A G 15: 89,186,827 probably benign Het
Fut10 T A 8: 31,236,020 Y268N possibly damaging Het
Glrx3 T C 7: 137,459,117 probably benign Het
Gucy1b2 T A 14: 62,404,627 N697I probably damaging Het
Ifi208 T C 1: 173,682,872 S198P possibly damaging Het
Krt34 A G 11: 100,039,031 V213A probably damaging Het
Lats2 T C 14: 57,691,541 N959S probably damaging Het
Mat1a A G 14: 41,121,381 Y288C probably damaging Het
Mtif2 A T 11: 29,540,718 H474L probably benign Het
Myh8 A G 11: 67,301,918 I1512V probably damaging Het
Nkx2-6 T C 14: 69,172,027 S76P probably benign Het
Noxred1 G A 12: 87,233,466 R31W probably benign Het
Olfr1241 T A 2: 89,482,896 M80L probably benign Het
Olfr310 T A 7: 86,269,495 Q98L probably damaging Het
Pcdhb16 C A 18: 37,478,287 T100K probably benign Het
Pcdhga10 T C 18: 37,748,331 C382R probably damaging Het
Pdgfra A T 5: 75,189,287 Y944F possibly damaging Het
Pkhd1 A G 1: 20,555,129 I741T possibly damaging Het
Ppp1r10 A G 17: 35,930,868 D845G unknown Het
Rfk C A 19: 17,399,470 probably null Het
Rgs11 C T 17: 26,204,328 probably benign Het
Spata31d1b T C 13: 59,717,891 V951A probably benign Het
St3gal5 T C 6: 72,149,029 V286A probably benign Het
St7l T C 3: 104,891,554 M320T probably benign Het
Tnfrsf1b G T 4: 145,227,522 Q86K probably benign Het
Tox T C 4: 6,697,535 I423V probably benign Het
Tpbpa T A 13: 60,940,013 H88L probably benign Het
Vmn1r236 A G 17: 21,286,806 Y62C probably benign Het
Ythdc1 A G 5: 86,822,667 I399M probably damaging Het
Zfp948 T G 17: 21,587,576 D343E probably benign Het
Zswim6 A G 13: 107,726,541 noncoding transcript Het
Other mutations in Chsy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Chsy1 APN 7 66172126 missense possibly damaging 0.70
IGL01734:Chsy1 APN 7 66171310 missense probably damaging 0.98
IGL02037:Chsy1 APN 7 66171828 missense possibly damaging 0.69
IGL02797:Chsy1 APN 7 66171664 missense probably damaging 1.00
IGL02961:Chsy1 APN 7 66171782 missense probably benign 0.00
IGL03290:Chsy1 APN 7 66171031 missense probably benign 0.15
IGL03292:Chsy1 APN 7 66125372 missense probably benign 0.02
deprimido UTSW 7 66171687 missense probably damaging 1.00
Elevado UTSW 7 66110076 nonsense probably null
R0669:Chsy1 UTSW 7 66171687 missense probably damaging 1.00
R1336:Chsy1 UTSW 7 66125239 splice site probably null
R1499:Chsy1 UTSW 7 66172002 missense probably damaging 1.00
R1640:Chsy1 UTSW 7 66171514 missense probably benign 0.34
R1674:Chsy1 UTSW 7 66171663 missense probably damaging 1.00
R1812:Chsy1 UTSW 7 66171817 missense probably benign 0.12
R1934:Chsy1 UTSW 7 66172243 missense probably damaging 1.00
R2964:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2965:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2966:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R4890:Chsy1 UTSW 7 66110226 missense probably benign 0.00
R5373:Chsy1 UTSW 7 66110076 nonsense probably null
R5936:Chsy1 UTSW 7 66172277 missense possibly damaging 0.89
R6149:Chsy1 UTSW 7 66125385 missense probably damaging 1.00
R6192:Chsy1 UTSW 7 66170877 missense probably benign 0.29
R6653:Chsy1 UTSW 7 66110193 missense probably benign 0.10
R6848:Chsy1 UTSW 7 66171037 missense probably damaging 1.00
R7318:Chsy1 UTSW 7 66110229 critical splice donor site probably null
X0012:Chsy1 UTSW 7 66172168 missense probably damaging 1.00
X0063:Chsy1 UTSW 7 66171924 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGCAAGTACAGCAGCACG -3'
(R):5'- TCTTGCTGAAGGTCTGCTGC -3'

Sequencing Primer
(F):5'- GTACAGCAGCACGGAGATCC -3'
(R):5'- CTGAAGGTCTGCTGCAGGTAC -3'
Posted On2015-02-19