Incidental Mutation 'R3692:Rfk'
ID268846
Institutional Source Beutler Lab
Gene Symbol Rfk
Ensembl Gene ENSMUSG00000024712
Gene Nameriboflavin kinase
Synonymsflavokinase, 0610038L10Rik, ATP:riboflavin 5'-phosphotransferase
MMRRC Submission 040687-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3692 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location17394043-17401349 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 17399470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025617]
Predicted Effect probably null
Transcript: ENSMUST00000025617
SMART Domains Protein: ENSMUSP00000025617
Gene: ENSMUSG00000024712

DomainStartEndE-ValueType
Flavokinase 1 131 5.68e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146171
Meta Mutation Damage Score 0.6104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Riboflavin kinase (RFK; EC 2.7.1.26) is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis (Karthikeyan et al., 2003 [PubMed 12623014]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele die in utero prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,269,509 D598G probably damaging Het
Adam1a T C 5: 121,519,322 D636G probably damaging Het
Adgrv1 A G 13: 81,524,600 V2218A possibly damaging Het
Ano5 T A 7: 51,590,579 Y752N probably damaging Het
Calca T C 7: 114,634,561 E45G probably damaging Het
Cdk8 C T 5: 146,283,668 R166* probably null Het
Chsy1 T A 7: 66,171,253 M412K probably damaging Het
Cic T A 7: 25,288,913 Y1675* probably null Het
Col1a2 T A 6: 4,510,710 D53E possibly damaging Het
Dennd6b A G 15: 89,186,827 probably benign Het
Fut10 T A 8: 31,236,020 Y268N possibly damaging Het
Glrx3 T C 7: 137,459,117 probably benign Het
Gucy1b2 T A 14: 62,404,627 N697I probably damaging Het
Ifi208 T C 1: 173,682,872 S198P possibly damaging Het
Krt34 A G 11: 100,039,031 V213A probably damaging Het
Lats2 T C 14: 57,691,541 N959S probably damaging Het
Mat1a A G 14: 41,121,381 Y288C probably damaging Het
Mtif2 A T 11: 29,540,718 H474L probably benign Het
Myh8 A G 11: 67,301,918 I1512V probably damaging Het
Nkx2-6 T C 14: 69,172,027 S76P probably benign Het
Noxred1 G A 12: 87,233,466 R31W probably benign Het
Olfr1241 T A 2: 89,482,896 M80L probably benign Het
Olfr310 T A 7: 86,269,495 Q98L probably damaging Het
Pcdhb16 C A 18: 37,478,287 T100K probably benign Het
Pcdhga10 T C 18: 37,748,331 C382R probably damaging Het
Pdgfra A T 5: 75,189,287 Y944F possibly damaging Het
Pkhd1 A G 1: 20,555,129 I741T possibly damaging Het
Ppp1r10 A G 17: 35,930,868 D845G unknown Het
Rgs11 C T 17: 26,204,328 probably benign Het
Spata31d1b T C 13: 59,717,891 V951A probably benign Het
St3gal5 T C 6: 72,149,029 V286A probably benign Het
St7l T C 3: 104,891,554 M320T probably benign Het
Tnfrsf1b G T 4: 145,227,522 Q86K probably benign Het
Tox T C 4: 6,697,535 I423V probably benign Het
Tpbpa T A 13: 60,940,013 H88L probably benign Het
Vmn1r236 A G 17: 21,286,806 Y62C probably benign Het
Ythdc1 A G 5: 86,822,667 I399M probably damaging Het
Zfp948 T G 17: 21,587,576 D343E probably benign Het
Zswim6 A G 13: 107,726,541 noncoding transcript Het
Other mutations in Rfk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Rfk APN 19 17395336 missense probably benign
IGL03124:Rfk APN 19 17398595 missense possibly damaging 0.53
PIT4544001:Rfk UTSW 19 17395344 missense probably damaging 1.00
R1193:Rfk UTSW 19 17395321 missense probably damaging 0.99
R2360:Rfk UTSW 19 17398596 missense probably benign 0.01
R4151:Rfk UTSW 19 17395308 missense probably benign 0.03
R4428:Rfk UTSW 19 17398595 missense possibly damaging 0.53
R5072:Rfk UTSW 19 17398599 missense possibly damaging 0.79
R5121:Rfk UTSW 19 17399566 missense probably damaging 1.00
R5469:Rfk UTSW 19 17395202 missense probably damaging 1.00
R5715:Rfk UTSW 19 17398638 missense probably benign 0.00
R5851:Rfk UTSW 19 17395198 missense probably damaging 1.00
R6050:Rfk UTSW 19 17399532 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTGTGACATTAAACCCTGGGAGG -3'
(R):5'- CACTGTGACACTATGCGTGAC -3'

Sequencing Primer
(F):5'- AGGTGAAGGGTCTCTTTACAAG -3'
(R):5'- TGACACTATGCGTGACACTAGTG -3'
Posted On2015-02-19