Incidental Mutation 'R3552:Hjurp'
ID268966
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R3552 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GT to GTT at 88266524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- ACTGTCATGGTTTGTGATGCCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On2015-02-19