Incidental Mutation 'R3552:0610009O20Rik'
List |< first << previous [record 21 of 386652] next >> last >|
ID269023
Institutional Source Beutler Lab
Gene Symbol 0610009O20Rik
Ensembl Gene ENSMUSG00000024442
Gene NameRIKEN cDNA 0610009O20 gene
Synonyms
MMRRC Submission
Accession Numbers
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38250249-38262629 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 38258365 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025314]
Predicted Effect probably benign
Transcript: ENSMUST00000025314
SMART Domains Protein: ENSMUSP00000025314
Gene: ENSMUSG00000024442

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
low complexity region 127 140 N/A INTRINSIC
SEL1 244 277 1.53e2 SMART
SEL1 278 313 2.8e-9 SMART
SEL1 314 351 3.3e1 SMART
SEL1 352 385 1.31e0 SMART
SEL1 386 421 1.67e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,546,856 I45V probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Ankrd44 C A 1: 54,663,931 R126L noncoding transcript Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Ccni T C 5: 93,187,761 S67G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 H104R probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E894V unknown Het
Esrrg G A 1: 188,150,190 V238I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fam178a C A 19: 44,934,951 S68* probably null Het
Fam21 A G 6: 116,220,568 D254G possibly damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gcfc2 A G 6: 81,951,765 D117G noncoding transcript Het
Gm5436 T C 12: 84,258,870 Y35C noncoding transcript Het
Gm9924 G A 5: 31,095,078 R32H noncoding transcript Het
Gm9944 T C 4: 144,453,043 N92S unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y211H probably benign Het
Kndc1 G A 7: 139,939,978 C827Y noncoding transcript Het
Lrrc16b G T 14: 55,507,402 R1276L possibly damaging Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D138G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 P44S possibly damaging Het
Neo1 T A 9: 58,893,878 K1167M probably damaging Het
Oc90 T C 15: 65,878,801 Q172R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P320L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E34G probably damaging Het
Ptprg C T 14: 12,220,064 T48I noncoding transcript Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 Y240* probably null Het
Ryr1 T A 7: 29,056,997 Q3457L probably damaging Het
Ryr3 T A 2: 112,751,787 I2879F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Smarcb1 A G 10: 75,897,036 M1115T noncoding transcript Het
Smyd5 G A 6: 85,442,211 E158K probably damaging Het
Spns1 A G 7: 126,370,371 V460A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Homo
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E2981D probably damaging Het
Trbc1 G T 6: 41,539,645 V167F not run Het
Trerf1 T C 17: 47,314,018 V115A noncoding transcript Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in 0610009O20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:0610009O20Rik APN 18 38252860 missense probably damaging 1.00
IGL02456:0610009O20Rik APN 18 38261124 missense probably damaging 1.00
R0134:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0225:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0511:0610009O20Rik UTSW 18 38254071 critical splice donor site probably null
R0560:0610009O20Rik UTSW 18 38254498 missense probably damaging 1.00
R1899:0610009O20Rik UTSW 18 38258342 missense probably benign 0.08
R3005:0610009O20Rik UTSW 18 38259959 missense possibly damaging 0.92
R4418:0610009O20Rik UTSW 18 38261287 unclassified probably null
X0067:0610009O20Rik UTSW 18 38258023 splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTCTGGTGGGATCTATC -3'
(R):5'- CCTCAGCTGAACAGTCTCTC -3'

Sequencing Primer
(F):5'- ATCTATCTTAGTGCAGTGTCAGAGCC -3'
(R):5'- TTTAACCTCAGCACCCCAGTGG -3'
Posted OnFeb 19, 2015