Incidental Mutation 'R3607:Prkg2'
ID269107
Institutional Source Beutler Lab
Gene Symbol Prkg2
Ensembl Gene ENSMUSG00000029334
Gene Nameprotein kinase, cGMP-dependent, type II
SynonymsPrkgr2, cGK-II
MMRRC Submission 040671-MU
Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location98929773-99037351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98947377 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 616 (T616K)
Ref Sequence ENSEMBL: ENSMUSP00000031277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490] [ENSMUST00000162147] [ENSMUST00000162619]
Predicted Effect probably damaging
Transcript: ENSMUST00000031277
AA Change: T616K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: T616K

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 424 682 9.46e-75 SMART
S_TK_X 683 733 9.83e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160765
Predicted Effect probably damaging
Transcript: ENSMUST00000161490
AA Change: T645K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: T645K

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 453 711 1.19e-89 SMART
S_TK_X 712 762 9.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162147
SMART Domains Protein: ENSMUSP00000143708
Gene: ENSMUSG00000029334

DomainStartEndE-ValueType
Blast:S_TKc 1 56 3e-32 BLAST
S_TK_X 57 107 4.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162619
SMART Domains Protein: ENSMUSP00000142743
Gene: ENSMUSG00000029334

DomainStartEndE-ValueType
Blast:S_TKc 1 43 8e-23 BLAST
S_TK_X 44 94 4.6e-6 SMART
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Tnfaip3 A G 10: 19,005,602 I312T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Prkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Prkg2 APN 5 99024541 missense probably benign 0.00
IGL01063:Prkg2 APN 5 98969936 critical splice donor site probably null
IGL02060:Prkg2 APN 5 99024515 missense probably benign 0.32
IGL02666:Prkg2 APN 5 98997519 splice site probably benign
IGL02992:Prkg2 APN 5 99024506 missense probably benign
IGL03040:Prkg2 APN 5 98973107 critical splice donor site probably null
devito UTSW 5 98966510 critical splice donor site probably null
P0005:Prkg2 UTSW 5 98969947 missense probably damaging 1.00
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0115:Prkg2 UTSW 5 98994655 splice site probably null
R0403:Prkg2 UTSW 5 98994645 missense possibly damaging 0.95
R0452:Prkg2 UTSW 5 98997520 splice site probably benign
R0481:Prkg2 UTSW 5 98994655 splice site probably null
R1194:Prkg2 UTSW 5 98971926 missense probably benign 0.00
R1534:Prkg2 UTSW 5 98994561 missense probably damaging 1.00
R1861:Prkg2 UTSW 5 98947416 missense probably damaging 1.00
R2010:Prkg2 UTSW 5 99024805 missense probably benign
R2031:Prkg2 UTSW 5 99024451 missense possibly damaging 0.85
R2176:Prkg2 UTSW 5 98966509 splice site probably benign
R3958:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R3960:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R4012:Prkg2 UTSW 5 98979815 missense possibly damaging 0.93
R4794:Prkg2 UTSW 5 98966633 missense probably damaging 1.00
R4840:Prkg2 UTSW 5 98981143 missense probably benign 0.03
R4867:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5182:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5226:Prkg2 UTSW 5 98976462 missense possibly damaging 0.92
R5274:Prkg2 UTSW 5 98969991 missense probably damaging 1.00
R5416:Prkg2 UTSW 5 98943467 missense probably benign 0.05
R5531:Prkg2 UTSW 5 98967734 missense probably damaging 1.00
R5619:Prkg2 UTSW 5 98988297 missense probably damaging 1.00
R6264:Prkg2 UTSW 5 98934364 missense probably benign 0.22
R6925:Prkg2 UTSW 5 98966510 critical splice donor site probably null
Z1088:Prkg2 UTSW 5 99024804 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTTACTGAACTAGGAAAACAGC -3'
(R):5'- GGAAATTTTGGACTCGTATGAAAGC -3'

Sequencing Primer
(F):5'- CTGAACTAGGAAAACAGCTTTCATC -3'
(R):5'- AACAGAAACTTAAAAGCAGCATAAC -3'
Posted On2015-02-19