Incidental Mutation 'R3607:Tnfaip3'
ID269125
Institutional Source Beutler Lab
Gene Symbol Tnfaip3
Ensembl Gene ENSMUSG00000019850
Gene Nametumor necrosis factor, alpha-induced protein 3
SynonymsA20, zinc finger protein A20, Tnfip3
MMRRC Submission 040671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3607 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location19000910-19015657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19005602 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 312 (I312T)
Ref Sequence ENSEMBL: ENSMUSP00000101167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019997] [ENSMUST00000105527] [ENSMUST00000122863]
Predicted Effect probably damaging
Transcript: ENSMUST00000019997
AA Change: I312T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019997
Gene: ENSMUSG00000019850
AA Change: I312T

DomainStartEndE-ValueType
Pfam:OTU 98 257 1.2e-30 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105527
AA Change: I312T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101167
Gene: ENSMUSG00000019850
AA Change: I312T

DomainStartEndE-ValueType
Pfam:OTU 98 257 7.8e-34 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122863
SMART Domains Protein: ENSMUSP00000116318
Gene: ENSMUSG00000019850

DomainStartEndE-ValueType
PDB:2VFJ|D 1 122 2e-83 PDB
SCOP:d1e3ha3 18 109 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154749
Meta Mutation Damage Score 0.394 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik C A 9: 53,279,783 noncoding transcript Het
Adnp2 A T 18: 80,129,069 N708K probably damaging Het
Arhgef17 C A 7: 100,931,172 G190W probably damaging Het
Aspm T A 1: 139,480,668 M2431K probably benign Het
Aurkc A G 7: 7,002,860 Y157C probably damaging Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Etv1 A G 12: 38,831,086 Y66C probably damaging Het
F830016B08Rik A T 18: 60,300,708 K288* probably null Het
Fam131a C T 16: 20,701,595 P181L probably damaging Het
Fat2 T A 11: 55,281,685 E2734V probably damaging Het
Fgfrl1 C A 5: 108,705,423 T213K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gmfg T A 7: 28,441,536 probably null Het
Gtpbp8 T C 16: 44,743,756 Y184C probably damaging Het
Heatr5b T C 17: 78,834,217 E2G probably damaging Het
Itpr2 T G 6: 146,227,601 T2005P probably damaging Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kng1 T C 16: 23,067,802 F112L probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lpin2 T A 17: 71,229,392 D225E probably damaging Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nkrf T G X: 36,890,077 N184T probably benign Het
Nt5c1b A G 12: 10,377,236 N329D probably damaging Het
Ogdhl T A 14: 32,335,361 V308E probably damaging Het
Olfr304 A G 7: 86,385,695 C322R probably benign Het
Pcnx T A 12: 81,928,292 F791I probably damaging Het
Prkg2 G T 5: 98,947,377 T616K probably damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptpn1 A G 2: 167,975,507 S355G probably benign Het
Pxdn A G 12: 29,990,918 N398D probably benign Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rgl3 A G 9: 21,987,691 S151P probably damaging Het
Rnf213 C A 11: 119,441,976 C2670* probably null Het
Tex16 T A X: 112,093,970 S159T probably damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Trpm7 T C 2: 126,796,428 probably benign Het
Usp11 T G X: 20,714,632 F426L probably damaging Het
Vcan G T 13: 89,703,301 T1180K probably damaging Het
Wasf1 G C 10: 40,936,384 A390P unknown Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Other mutations in Tnfaip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
lasvegas APN 10 19010758 unclassified probably benign
IGL00840:Tnfaip3 APN 10 19005126 missense probably damaging 1.00
IGL00966:Tnfaip3 APN 10 19005137 missense probably damaging 1.00
IGL01080:Tnfaip3 APN 10 19011655 missense probably benign 0.03
IGL01736:Tnfaip3 APN 10 19006901 missense probably damaging 1.00
IGL02318:Tnfaip3 APN 10 19004467 missense probably benign 0.04
IGL02703:Tnfaip3 APN 10 19007032 missense probably damaging 0.98
IGL03032:Tnfaip3 APN 10 19004609 missense probably benign
IGL03331:Tnfaip3 APN 10 19011601 missense possibly damaging 0.63
IGL03389:Tnfaip3 APN 10 19004987 missense probably benign 0.03
PIT4243001:Tnfaip3 UTSW 10 19011574 missense probably damaging 1.00
PIT4480001:Tnfaip3 UTSW 10 19007323 missense probably benign
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0056:Tnfaip3 UTSW 10 19005293 missense probably damaging 1.00
R0195:Tnfaip3 UTSW 10 19005713 missense probably damaging 1.00
R0226:Tnfaip3 UTSW 10 19002747 missense probably damaging 1.00
R0369:Tnfaip3 UTSW 10 19006912 nonsense probably null
R0744:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R0833:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1876:Tnfaip3 UTSW 10 19004934 missense possibly damaging 0.81
R1902:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1903:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1922:Tnfaip3 UTSW 10 19003607 missense possibly damaging 0.51
R1973:Tnfaip3 UTSW 10 19004504 missense probably damaging 0.98
R2040:Tnfaip3 UTSW 10 19008152 missense possibly damaging 0.89
R2513:Tnfaip3 UTSW 10 19005659 missense probably benign 0.00
R2936:Tnfaip3 UTSW 10 19011609 missense probably damaging 1.00
R4386:Tnfaip3 UTSW 10 19007010 missense probably damaging 1.00
R4483:Tnfaip3 UTSW 10 19011627 missense probably damaging 1.00
R4673:Tnfaip3 UTSW 10 19011832 intron probably benign
R4879:Tnfaip3 UTSW 10 19005573 missense probably benign 0.03
R5082:Tnfaip3 UTSW 10 19005284 missense probably damaging 1.00
R5524:Tnfaip3 UTSW 10 19008195 missense probably damaging 0.98
R6559:Tnfaip3 UTSW 10 19007248 missense probably damaging 1.00
R6776:Tnfaip3 UTSW 10 19005576 missense probably benign 0.02
R6853:Tnfaip3 UTSW 10 19003751 missense probably benign
R6891:Tnfaip3 UTSW 10 19011669 missense probably damaging 1.00
R7144:Tnfaip3 UTSW 10 19007281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTTCCACAATGCAGTCGTG -3'
(R):5'- ATATCTGCACCATCATTTAGCAGG -3'

Sequencing Primer
(F):5'- GCAGTCGTGGCAATAACTTC -3'
(R):5'- CACTTCTTGACAGATCCTG -3'
Posted On2015-02-19