Incidental Mutation 'R3608:Speer4f2'
ID269153
Institutional Source Beutler Lab
Gene Symbol Speer4f2
Ensembl Gene ENSMUSG00000091827
Gene Namespermatogenesis associated glutamate (E)-rich protein 4f2
SynonymsGm3535, Gm3495
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3608 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location17373180-17378028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17374494 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 97 (T97K)
Ref Sequence ENSEMBL: ENSMUSP00000129818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166086]
Predicted Effect probably benign
Transcript: ENSMUST00000166086
AA Change: T97K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: T97K

DomainStartEndE-ValueType
Pfam:Takusan 34 112 9.6e-20 PFAM
low complexity region 208 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gnt4 C A 5: 123,510,775 R68S probably damaging Het
Brf1 A G 12: 112,961,274 L610P probably benign Het
Cacna1e T A 1: 154,416,085 R1783S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
CK137956 A T 4: 127,951,326 I208N probably damaging Het
Col17a1 G A 19: 47,680,405 L127F probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlgap4 C T 2: 156,748,412 probably benign Het
Ect2l A T 10: 18,142,940 N619K possibly damaging Het
Hamp2 T C 7: 30,924,114 T8A probably benign Het
Lamb1 T A 12: 31,287,910 N407K probably damaging Het
Lrrc32 C T 7: 98,499,186 T391M probably benign Het
Mroh2a G T 1: 88,244,995 A829S probably damaging Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Pcnx2 T C 8: 125,888,101 T204A probably benign Het
Ppil2 A T 16: 17,092,290 C126* probably null Het
Psmc3 T A 2: 91,054,580 D30E probably benign Het
Rtkn T A 6: 83,150,035 C328S probably damaging Het
Srd5a2 A G 17: 74,027,031 V131A probably benign Het
Tm9sf4 A G 2: 153,178,977 H35R probably benign Het
Ubr2 G T 17: 46,944,523 D1412E probably damaging Het
Vmn2r95 G A 17: 18,439,973 V216I possibly damaging Het
Other mutations in Speer4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Speer4f2 APN 5 17376567 missense possibly damaging 0.94
IGL02092:Speer4f2 APN 5 17376629 nonsense probably null
IGL03100:Speer4f2 APN 5 17376530 missense probably damaging 0.99
R0939:Speer4f2 UTSW 5 17374404 missense probably damaging 0.99
R1384:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R1528:Speer4f2 UTSW 5 17376542 missense
R1873:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R4972:Speer4f2 UTSW 5 17374425 missense probably benign 0.27
R5421:Speer4f2 UTSW 5 17374358 missense possibly damaging 0.88
R5450:Speer4f2 UTSW 5 17373219 missense possibly damaging 0.85
R5452:Speer4f2 UTSW 5 17376500 missense possibly damaging 0.93
R5531:Speer4f2 UTSW 5 17376528 missense possibly damaging 0.57
R5924:Speer4f2 UTSW 5 17376624 missense probably damaging 1.00
R6454:Speer4f2 UTSW 5 17374433 missense probably damaging 0.99
R6553:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6585:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6649:Speer4f2 UTSW 5 17375769 missense probably benign 0.05
R6878:Speer4f2 UTSW 5 17375767 missense probably damaging 0.99
R7089:Speer4f2 UTSW 5 17376663 missense
R7129:Speer4f2 UTSW 5 17377448 missense
R7448:Speer4f2 UTSW 5 17376542 missense
Predicted Primers PCR Primer
(F):5'- GGCATGTATTCCTTCTCTGTAGACAG -3'
(R):5'- TCCTGACAAAGCTTCAGGCC -3'

Sequencing Primer
(F):5'- CTGTAGACAGTCTAAACTCTTTGC -3'
(R):5'- GGCCTTGCCTCTCCTTTAAAAAGTG -3'
Posted On2015-02-19