Incidental Mutation 'R3608:Vmn2r95'
ID269169
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Namevomeronasal 2, receptor 95
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R3608 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18424078-18460905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18439973 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 216 (V216I)
Ref Sequence ENSEMBL: ENSMUSP00000156117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166327
AA Change: V216I

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: V216I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000232090
AA Change: V216I

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000232464
AA Change: V216I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gnt4 C A 5: 123,510,775 R68S probably damaging Het
Brf1 A G 12: 112,961,274 L610P probably benign Het
Cacna1e T A 1: 154,416,085 R1783S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
CK137956 A T 4: 127,951,326 I208N probably damaging Het
Col17a1 G A 19: 47,680,405 L127F probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlgap4 C T 2: 156,748,412 probably benign Het
Ect2l A T 10: 18,142,940 N619K possibly damaging Het
Hamp2 T C 7: 30,924,114 T8A probably benign Het
Lamb1 T A 12: 31,287,910 N407K probably damaging Het
Lrrc32 C T 7: 98,499,186 T391M probably benign Het
Mroh2a G T 1: 88,244,995 A829S probably damaging Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Pcnx2 T C 8: 125,888,101 T204A probably benign Het
Ppil2 A T 16: 17,092,290 C126* probably null Het
Psmc3 T A 2: 91,054,580 D30E probably benign Het
Rtkn T A 6: 83,150,035 C328S probably damaging Het
Speer4f2 C A 5: 17,374,494 T97K probably benign Het
Srd5a2 A G 17: 74,027,031 V131A probably benign Het
Tm9sf4 A G 2: 153,178,977 H35R probably benign Het
Ubr2 G T 17: 46,944,523 D1412E probably damaging Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18452328 utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18443862 missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18451475 missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18440211 missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18439907 missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18451986 missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18451776 missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18439956 missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18451732 missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18443854 missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18451858 missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18452036 nonsense probably null
IGL03032:Vmn2r95 APN 17 18452313 missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18441402 missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18451743 missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18451582 missense probably benign
R0519:Vmn2r95 UTSW 17 18439503 missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18452100 missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18439856 missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18452313 missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18440639 splice site probably benign
R1861:Vmn2r95 UTSW 17 18452268 missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18424313 missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18451543 missense probably benign
R2031:Vmn2r95 UTSW 17 18439455 missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18441299 missense probably damaging 1.00
R3727:Vmn2r95 UTSW 17 18441482 nonsense probably null
R3953:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3955:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18452245 missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18452151 missense probably damaging 1.00
R4850:Vmn2r95 UTSW 17 18451653 missense probably damaging 1.00
R5054:Vmn2r95 UTSW 17 18451446 missense possibly damaging 0.63
R5178:Vmn2r95 UTSW 17 18440075 missense probably benign 0.01
R5980:Vmn2r95 UTSW 17 18441362 missense probably benign
R6183:Vmn2r95 UTSW 17 18443930 missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18451470 missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18440360 missense probably damaging 1.00
R6682:Vmn2r95 UTSW 17 18440227 missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18452289 utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18439293 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443919 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443920 missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18452061 missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18441315 missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18451983 missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18451963 missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18440472 missense probably benign 0.06
Z1088:Vmn2r95 UTSW 17 18440401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGTCCTTGAAACTTAGAGGCC -3'
(R):5'- ACCTTCTAGTGAATCAATGTCACC -3'

Sequencing Primer
(F):5'- ATTCTCTTGTCTTCTATTCCTTCAGG -3'
(R):5'- GAAGTCCATGTTTCTGAGG -3'
Posted On2015-02-19