Incidental Mutation 'R3609:2210407C18Rik'
ID269190
Institutional Source Beutler Lab
Gene Symbol 2210407C18Rik
Ensembl Gene ENSMUSG00000037145
Gene NameRIKEN cDNA 2210407C18 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3609 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58608204-58616075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58612558 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 48 (T48I)
Ref Sequence ENSEMBL: ENSMUSP00000104449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048801] [ENSMUST00000108821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048801
AA Change: T48I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039283
Gene: ENSMUSG00000037145
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108821
AA Change: T48I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104449
Gene: ENSMUSG00000037145
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126695
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifc A T 10: 86,000,638 M1K probably null Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Ces1c A T 8: 93,120,332 I98N probably damaging Het
Clec4b1 T A 6: 123,050,632 L16Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dopey2 A G 16: 93,739,332 Y106C probably damaging Het
Irak3 G T 10: 120,145,677 T441K possibly damaging Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Olfr1042 G A 2: 86,159,632 T246I probably benign Het
Olfr1056 G C 2: 86,355,482 A300G probably damaging Het
Olfr1256 A G 2: 89,835,076 S290P probably damaging Het
Olfr480 A G 7: 108,066,369 F143S probably damaging Het
Rest A C 5: 77,282,800 N1022T probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Vmn2r71 T A 7: 85,619,662 C358S probably damaging Het
Other mutations in 2210407C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:2210407C18Rik APN 11 58612881 utr 5 prime probably benign
IGL02341:2210407C18Rik APN 11 58612830 missense possibly damaging 0.70
IGL02609:2210407C18Rik APN 11 58612616 missense probably damaging 1.00
R0466:2210407C18Rik UTSW 11 58612505 splice site probably benign
R0598:2210407C18Rik UTSW 11 58608404 missense probably benign 0.27
R0612:2210407C18Rik UTSW 11 58611973 splice site probably null
R2352:2210407C18Rik UTSW 11 58612108 nonsense probably null
R2352:2210407C18Rik UTSW 11 58612850 missense probably damaging 1.00
R2439:2210407C18Rik UTSW 11 58610777 missense probably damaging 1.00
R2910:2210407C18Rik UTSW 11 58608426 nonsense probably null
R2911:2210407C18Rik UTSW 11 58608426 nonsense probably null
R2991:2210407C18Rik UTSW 11 58610690 missense possibly damaging 0.81
R4863:2210407C18Rik UTSW 11 58612512 critical splice donor site probably null
R4925:2210407C18Rik UTSW 11 58610687 missense probably damaging 0.96
R6954:2210407C18Rik UTSW 11 58608488 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCCCAAATGGTCCTGATCATG -3'
(R):5'- GTAAGCAGTCAAGTACCTGGGG -3'

Sequencing Primer
(F):5'- CCCAAATGGTCCTGATCATGTAGAG -3'
(R):5'- GGTAGCCAACCCCATGAG -3'
Posted On2015-02-19