Incidental Mutation 'R3610:Vim'
List |< first << previous [record 20 of 20]
ID269196
Institutional Source Beutler Lab
Gene Symbol Vim
Ensembl Gene ENSMUSG00000026728
Gene Namevimentin
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location13573927-13582826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13578626 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 253 (H253L)
Ref Sequence ENSEMBL: ENSMUSP00000141494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028062] [ENSMUST00000141365] [ENSMUST00000193675]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028062
AA Change: H253L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028062
Gene: ENSMUSG00000026728
AA Change: H253L

DomainStartEndE-ValueType
Pfam:Filament_head 6 101 7.8e-23 PFAM
Filament 102 410 6.65e-150 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141365
SMART Domains Protein: ENSMUSP00000114742
Gene: ENSMUSG00000026728

DomainStartEndE-ValueType
Pfam:Filament_head 6 101 1.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191615
Predicted Effect possibly damaging
Transcript: ENSMUST00000193675
AA Change: H253L

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141494
Gene: ENSMUSG00000026728
AA Change: H253L

DomainStartEndE-ValueType
Pfam:Filament_head 6 101 3.8e-19 PFAM
Pfam:Filament 102 410 3.6e-116 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family. Intermediate filamentents, along with microtubules and actin microfilaments, make up the cytoskeleton. The protein encoded by this gene is responsible for maintaining cell shape, integrity of the cytoplasm, and stabilizing cytoskeletal interactions. It is also involved in the immune response, and controls the transport of low-density lipoprotein (LDL)-derived cholesterol from a lysosome to the site of esterification. It functions as an organizer of a number of critical proteins involved in attachment, migration, and cell signaling. Mutations in this gene causes a dominant, pulverulent cataract.[provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants exhibit impaired performance in motor coordination tests; cerebellum shows underdeveloped/abnormal Bergman glia and stunted, poorly branched Purkinje cells. Mutants are unable to survive experimental 75% reduction of kidney mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Other mutations in Vim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Vim APN 2 13578510 critical splice donor site probably null
IGL01660:Vim APN 2 13574813 missense probably damaging 1.00
IGL01868:Vim APN 2 13578438 missense possibly damaging 0.69
IGL02166:Vim APN 2 13574594 missense probably damaging 1.00
IGL02867:Vim APN 2 13580680 missense probably damaging 1.00
IGL02889:Vim APN 2 13580680 missense probably damaging 1.00
R0276:Vim UTSW 2 13574859 missense probably benign 0.01
R0626:Vim UTSW 2 13574652 missense probably benign 0.00
R1695:Vim UTSW 2 13580110 missense probably benign 0.00
R1712:Vim UTSW 2 13578459 missense probably damaging 0.98
R3609:Vim UTSW 2 13578626 missense possibly damaging 0.67
R3810:Vim UTSW 2 13578752 critical splice donor site probably null
R4063:Vim UTSW 2 13580016 critical splice acceptor site probably null
R4347:Vim UTSW 2 13575518 intron probably benign
R4647:Vim UTSW 2 13582495 missense probably benign 0.18
R4678:Vim UTSW 2 13574964 missense probably damaging 1.00
R5261:Vim UTSW 2 13574832 missense probably null 1.00
R5342:Vim UTSW 2 13580013 splice site probably null
R5488:Vim UTSW 2 13575581 missense probably benign 0.01
R5838:Vim UTSW 2 13580190 missense probably damaging 1.00
R5988:Vim UTSW 2 13582485 missense probably benign 0.01
X0018:Vim UTSW 2 13574748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGAACGGAAAGTGGAATCC -3'
(R):5'- AGCCAGCTTCTGAGTAGAGC -3'

Sequencing Primer
(F):5'- TCCTTGCAGGAAGAAATTGCC -3'
(R):5'- TACTAATGGAATTAGAGGCACGTGTC -3'
Posted On2015-02-19