Incidental Mutation 'R3610:Tmem184a'
List |< first << previous [record 16 of 20] next >> last >|
ID269202
Institutional Source Beutler Lab
Gene Symbol Tmem184a
Ensembl Gene ENSMUSG00000036687
Gene Nametransmembrane protein 184a
SynonymsSdmg1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139802485-139819917 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 139807955 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044002] [ENSMUST00000044002] [ENSMUST00000110832] [ENSMUST00000110832] [ENSMUST00000146780] [ENSMUST00000182839]
Predicted Effect probably null
Transcript: ENSMUST00000044002
SMART Domains Protein: ENSMUSP00000035399
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 46 54 N/A INTRINSIC
Pfam:Solute_trans_a 82 356 2.2e-93 PFAM
low complexity region 408 435 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000044002
SMART Domains Protein: ENSMUSP00000035399
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 46 54 N/A INTRINSIC
Pfam:Solute_trans_a 82 356 2.2e-93 PFAM
low complexity region 408 435 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110832
SMART Domains Protein: ENSMUSP00000106456
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Pfam:Solute_trans_a 55 332 6.7e-101 PFAM
low complexity region 384 411 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110832
SMART Domains Protein: ENSMUSP00000106456
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Pfam:Solute_trans_a 55 332 6.7e-101 PFAM
low complexity region 384 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132677
Predicted Effect probably benign
Transcript: ENSMUST00000146780
SMART Domains Protein: ENSMUSP00000117714
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182839
SMART Domains Protein: ENSMUSP00000138120
Gene: ENSMUSG00000098140

DomainStartEndE-ValueType
Pfam:DUF2372 34 82 2e-14 PFAM
low complexity region 94 102 N/A INTRINSIC
Pfam:Solute_trans_a 127 226 3.5e-36 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Tmem184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Tmem184a APN 5 139813144 missense possibly damaging 0.90
IGL02111:Tmem184a APN 5 139813101 missense possibly damaging 0.92
IGL02483:Tmem184a APN 5 139813077 missense probably benign 0.01
IGL03352:Tmem184a APN 5 139813000 missense probably damaging 0.98
R1488:Tmem184a UTSW 5 139807640 missense probably benign 0.14
R1950:Tmem184a UTSW 5 139807626 missense probably damaging 1.00
R4690:Tmem184a UTSW 5 139805622 missense probably benign 0.01
R4977:Tmem184a UTSW 5 139808002 missense probably null 0.57
R6247:Tmem184a UTSW 5 139813072 missense probably benign 0.02
R6497:Tmem184a UTSW 5 139813000 missense probably damaging 0.99
R6515:Tmem184a UTSW 5 139808438 missense probably benign 0.39
R7348:Tmem184a UTSW 5 139814054 missense probably null 0.12
Predicted Primers PCR Primer
(F):5'- CGGGTTTCACAATGCAGAAC -3'
(R):5'- CCGACTGTATCTGATGGGAGTC -3'

Sequencing Primer
(F):5'- GTTTCACAATGCAGAACTGGAG -3'
(R):5'- ATCTGATGGGAGTCTTGCTTGCAG -3'
Posted On2015-02-19