Incidental Mutation 'R3610:Usp17la'
List |< first << previous [record 19 of 20] next >> last >|
ID269204
Institutional Source Beutler Lab
Gene Symbol Usp17la
Ensembl Gene ENSMUSG00000054568
Gene Nameubiquitin specific peptidase 17-like A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104857009-104862667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104861072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 295 (V295I)
Ref Sequence ENSEMBL: ENSMUSP00000068997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067695]
Predicted Effect probably damaging
Transcript: ENSMUST00000067695
AA Change: V295I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068997
Gene: ENSMUSG00000054568
AA Change: V295I

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.3e-53 PFAM
Pfam:UCH_1 51 328 1.1e-24 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Usp17la
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Usp17la APN 7 104861315 missense probably benign 0.04
IGL01482:Usp17la APN 7 104859393 start codon destroyed probably benign 0.28
IGL02236:Usp17la APN 7 104861146 nonsense probably null
IGL03239:Usp17la APN 7 104860620 missense possibly damaging 0.69
R0512:Usp17la UTSW 7 104861039 missense possibly damaging 0.50
R1632:Usp17la UTSW 7 104860911 missense probably benign 0.02
R1828:Usp17la UTSW 7 104861124 missense probably damaging 1.00
R1918:Usp17la UTSW 7 104860746 missense probably benign 0.11
R1976:Usp17la UTSW 7 104860320 missense possibly damaging 0.81
R2058:Usp17la UTSW 7 104861171 missense probably damaging 1.00
R2059:Usp17la UTSW 7 104861171 missense probably damaging 1.00
R2078:Usp17la UTSW 7 104859393 start codon destroyed probably benign 0.28
R2197:Usp17la UTSW 7 104860712 missense probably damaging 1.00
R3684:Usp17la UTSW 7 104861730 missense possibly damaging 0.96
R4480:Usp17la UTSW 7 104860690 missense probably benign 0.15
R4633:Usp17la UTSW 7 104860221 missense possibly damaging 0.92
R4701:Usp17la UTSW 7 104860649 nonsense probably null
R4907:Usp17la UTSW 7 104861148 missense probably damaging 1.00
R5057:Usp17la UTSW 7 104861123 missense possibly damaging 0.95
R5091:Usp17la UTSW 7 104860932 missense probably damaging 0.99
R5313:Usp17la UTSW 7 104861250 missense probably benign 0.00
R6269:Usp17la UTSW 7 104860350 missense possibly damaging 0.82
R7054:Usp17la UTSW 7 104861307 missense probably benign 0.38
R7395:Usp17la UTSW 7 104861585 missense probably benign 0.30
X0062:Usp17la UTSW 7 104861478 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGACCCTGCATGTTCATATTGC -3'
(R):5'- AGCTGGTATTCAGGGTCAAGAAC -3'

Sequencing Primer
(F):5'- TGCTCCAAAGGTACTCATGG -3'
(R):5'- CCCTCTGGCATGTCAATACTG -3'
Posted On2015-02-19