Incidental Mutation 'R3610:Irf2bpl'
List |< first << previous [record 8 of 20] next >> last >|
ID269209
Institutional Source Beutler Lab
Gene Symbol Irf2bpl
Ensembl Gene ENSMUSG00000034168
Gene Nameinterferon regulatory factor 2 binding protein-like
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location86880701-86884798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86881857 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 681 (I681V)
Ref Sequence ENSEMBL: ENSMUSP00000041070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038422]
Predicted Effect probably benign
Transcript: ENSMUST00000038422
AA Change: I681V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000041070
Gene: ENSMUSG00000034168
AA Change: I681V

DomainStartEndE-ValueType
Pfam:IRF-2BP1_2 10 61 2e-38 PFAM
low complexity region 70 78 N/A INTRINSIC
coiled coil region 84 113 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 258 300 N/A INTRINSIC
coiled coil region 314 350 N/A INTRINSIC
low complexity region 496 519 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 627 646 N/A INTRINSIC
PDB:2CS3|A 684 765 7e-52 PDB
SCOP:d1fbva4 692 738 4e-6 SMART
Blast:RING 694 745 4e-24 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that may play a role in regulating female reproductive function. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Irf2bpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03343:Irf2bpl APN 12 86882939 missense possibly damaging 0.72
twig UTSW 12 86883464 missense probably benign 0.01
PIT1430001:Irf2bpl UTSW 12 86883455 missense possibly damaging 0.91
R0218:Irf2bpl UTSW 12 86882624 missense probably benign 0.02
R0371:Irf2bpl UTSW 12 86881643 nonsense probably null
R0426:Irf2bpl UTSW 12 86883096 missense probably benign 0.06
R1351:Irf2bpl UTSW 12 86882624 missense probably benign 0.02
R2881:Irf2bpl UTSW 12 86882777 missense probably damaging 0.98
R4206:Irf2bpl UTSW 12 86883036 missense probably benign 0.00
R4240:Irf2bpl UTSW 12 86882917 missense possibly damaging 0.73
R4938:Irf2bpl UTSW 12 86882118 missense possibly damaging 0.73
R5451:Irf2bpl UTSW 12 86882072 missense probably benign 0.33
R6213:Irf2bpl UTSW 12 86883593 missense probably benign 0.18
R6491:Irf2bpl UTSW 12 86883464 missense probably benign 0.01
R6969:Irf2bpl UTSW 12 86882694 missense possibly damaging 0.86
R7151:Irf2bpl UTSW 12 86883353 missense probably benign 0.00
X0066:Irf2bpl UTSW 12 86881650 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAGGTACATTAGACCCGACTAGG -3'
(R):5'- ACTTTGGGCACAGCTCATTC -3'

Sequencing Primer
(F):5'- CGACTAGGGGGCATTTCTCTC -3'
(R):5'- CCAAGGACGGCAGTTCAGTG -3'
Posted On2015-02-19