Incidental Mutation 'R3610:Tsc2'
List |< first << previous [record 18 of 20] next >> last >|
ID269212
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Nametuberous sclerosis 2
Synonymstuberin, Nafld
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3610 (G1)
Quality Score171
Status Not validated
Chromosome17
Chromosomal Location24595816-24632630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24622550 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 365 (I365S)
Ref Sequence ENSEMBL: ENSMUSP00000154338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]
Predicted Effect probably benign
Transcript: ENSMUST00000097373
AA Change: I365S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: I365S

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226284
AA Change: I365S

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000226398
AA Change: I365S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227607
AA Change: I306S

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227745
AA Change: I365S

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227754
Predicted Effect probably benign
Transcript: ENSMUST00000228412
AA Change: I365S

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24608107 missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24597131 missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24613285 missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24621097 missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24622662 missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24600453 missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24621729 missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24629969 missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24628054 missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24619470 missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24597068 missense probably damaging 0.98
Twitch UTSW 17 24596742 unclassified probably null
PIT4515001:Tsc2 UTSW 17 24621147 missense probably benign 0.15
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0138:Tsc2 UTSW 17 24599626 missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24626727 missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24596958 missense probably benign 0.04
R1430:Tsc2 UTSW 17 24599023 critical splice donor site probably null
R1440:Tsc2 UTSW 17 24614392 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24631976 missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24597068 missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24604408 missense probably benign
R2030:Tsc2 UTSW 17 24623470 splice site probably benign
R2147:Tsc2 UTSW 17 24621142 missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24631995 critical splice donor site probably null
R3609:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24629037 missense probably benign 0.09
R3895:Tsc2 UTSW 17 24599812 missense probably damaging 1.00
R3962:Tsc2 UTSW 17 24621166 splice site probably benign
R3971:Tsc2 UTSW 17 24623588 missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24625281 missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24632016 missense probably benign 0.43
R4435:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4437:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4474:Tsc2 UTSW 17 24597264 missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24604909 missense probably benign 0.13
R4731:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24596742 unclassified probably null
R4890:Tsc2 UTSW 17 24600035 missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24600369 missense probably benign 0.22
R5119:Tsc2 UTSW 17 24603280 missense probably benign 0.00
R5393:Tsc2 UTSW 17 24600396 missense possibly damaging 0.89
R5785:Tsc2 UTSW 17 24599887 unclassified probably null
R5838:Tsc2 UTSW 17 24613216 missense probably benign 0.01
R5857:Tsc2 UTSW 17 24600007 missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24600387 missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24620766 missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24600420 missense probably benign 0.00
R6290:Tsc2 UTSW 17 24596910 missense probably benign 0.04
R6371:Tsc2 UTSW 17 24626714 missense probably benign 0.00
R6467:Tsc2 UTSW 17 24609127 missense probably benign 0.04
R6577:Tsc2 UTSW 17 24610499 missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24621124 missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24613229 missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24628054 missense probably damaging 1.00
R7026:Tsc2 UTSW 17 24626739 missense probably damaging 0.99
R7136:Tsc2 UTSW 17 24613280 missense probably benign 0.00
R7236:Tsc2 UTSW 17 24623594 missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24599630 missense probably benign 0.02
R7249:Tsc2 UTSW 17 24607755 missense probably damaging 1.00
R7450:Tsc2 UTSW 17 24600031 missense probably damaging 1.00
R7522:Tsc2 UTSW 17 24630965 missense not run
R7529:Tsc2 UTSW 17 24597948 missense not run
Predicted Primers PCR Primer
(F):5'- TGGAAGACAAACTGGCACC -3'
(R):5'- ACCCATCCATGCATTTACGC -3'

Sequencing Primer
(F):5'- TGGCACCAAGAGTCACCAG -3'
(R):5'- CAGGAGACAGGATGCTCTCATC -3'
Posted On2015-02-19