Incidental Mutation 'R3610:Ddx3y'
ID269216
Institutional Source Beutler Lab
Gene Symbol Ddx3y
Ensembl Gene ENSMUSG00000069045
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
SynonymsDby, D1Pas1-rs1, 8030469F12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R3610 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location1260771-1286629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 1263928 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 545 (N545S)
Ref Sequence ENSEMBL: ENSMUSP00000088729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091190] [ENSMUST00000188484]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084813
Predicted Effect probably null
Transcript: ENSMUST00000091190
AA Change: N545S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088729
Gene: ENSMUSG00000069045
AA Change: N545S

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
DEXDc 198 417 3.39e-65 SMART
HELICc 454 535 2.61e-34 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 603 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188182
Predicted Effect probably benign
Transcript: ENSMUST00000188484
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DEAD-box RNA helicase family, characterized by nine conserved motifs, included the conserved Asp-Glu-Ala-Asp (DEAD) motif. These motifs are thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. This protein shares high similarity to DDX3X, on the X chromosome, but a deletion of this gene is not complemented by DDX3X. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. Pseudogenes sharing similarity to both this gene and the DDX3X paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Ddx3y
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03134:Ddx3y UTSW Y 1278949 missense possibly damaging 0.93
R0326:Ddx3y UTSW Y 1263321 nonsense probably null
R1755:Ddx3y UTSW Y 1279543 missense probably benign 0.00
R2029:Ddx3y UTSW Y 1266389 missense probably benign 0.05
R2076:Ddx3y UTSW Y 1266593 critical splice donor site probably null
R3973:Ddx3y UTSW Y 1267170 missense probably damaging 1.00
R5041:Ddx3y UTSW Y 1266611 missense probably benign 0.05
R5396:Ddx3y UTSW Y 1265965 missense probably damaging 1.00
R6266:Ddx3y UTSW Y 1266635 missense probably damaging 1.00
R6473:Ddx3y UTSW Y 1265971 missense possibly damaging 0.93
R7048:Ddx3y UTSW Y 1279491 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTCCAAATCCTCCACTG -3'
(R):5'- CTTGTTCCAAAACCAGCCTAAGTAATC -3'

Sequencing Primer
(F):5'- AAATCCTCCACTGAATCTGCTATTG -3'
(R):5'- CCCATGGTCTACATAGTGGATAGC -3'
Posted On2015-02-19