Incidental Mutation 'R3611:Fmnl1'
ID269235
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Nameformin-like 1
Synonymsformin-related gene in leukocytes, 8030453N10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3611 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103171107-103198901 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 103194765 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021323] [ENSMUST00000042286] [ENSMUST00000107026] [ENSMUST00000107027] [ENSMUST00000129726] [ENSMUST00000172850] [ENSMUST00000218163]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000021322
Predicted Effect probably benign
Transcript: ENSMUST00000021323
SMART Domains Protein: ENSMUSP00000021323
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 7.23e1 SMART
EFh 145 173 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000042286
AA Change: N712S
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: N712S

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107026
SMART Domains Protein: ENSMUSP00000102641
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 40 68 7.23e1 SMART
EFh 76 104 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107027
AA Change: N712S
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: N712S

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect probably benign
Transcript: ENSMUST00000129726
SMART Domains Protein: ENSMUSP00000133299
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Pfam:FH2 1 50 8.2e-10 PFAM
low complexity region 124 139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect probably benign
Transcript: ENSMUST00000172850
SMART Domains Protein: ENSMUSP00000139837
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 3.5e-1 SMART
EFh 145 173 3.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174079
Predicted Effect unknown
Transcript: ENSMUST00000218163
AA Change: N718S
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 G A 6: 92,869,984 T521M probably benign Het
Ap1b1 A G 11: 5,024,427 K345R possibly damaging Het
Arhgap26 T C 18: 38,933,919 W53R probably benign Het
Brd1 A G 15: 88,700,944 S896P probably benign Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Chd3 A G 11: 69,362,147 S281P possibly damaging Het
Chl1 A G 6: 103,698,155 D601G probably damaging Het
Cntn3 C A 6: 102,208,077 V693L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
D1Ertd622e T C 1: 97,646,334 E2G probably damaging Het
Dsc2 A G 18: 20,032,351 V855A probably damaging Het
Fat2 T C 11: 55,312,069 M60V probably benign Het
Gnpda2 A G 5: 69,577,409 S268P probably benign Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Kmt2a A T 9: 44,822,466 probably benign Het
Lsg1 A G 16: 30,561,795 V608A probably benign Het
Mmrn2 G A 14: 34,398,675 V501M probably benign Het
Olfr45 G A 7: 140,691,100 C65Y probably benign Het
Ppa2 A G 3: 133,348,106 T186A probably benign Het
Rims4 T A 2: 163,879,206 I42F possibly damaging Het
Rnf17 A T 14: 56,467,740 E700D probably benign Het
Skor2 T C 18: 76,858,838 V85A unknown Het
Srbd1 T C 17: 86,102,927 T526A probably benign Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Ubtfl1 T C 9: 18,409,365 I63T probably damaging Het
Zfp616 A G 11: 74,083,442 K270R possibly damaging Het
Zfp750 G A 11: 121,512,155 P589L probably benign Het
Zfr G A 15: 12,159,762 probably null Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAGATTAACATCCCAGGAG -3'
(R):5'- AGACAATGCTCCCTGACCAG -3'

Sequencing Primer
(F):5'- AGACTCGGCTGCACTCAG -3'
(R):5'- TCTTGCCTAGCCTAGTGA -3'
Posted On2015-02-19