Mutagenetix > Incidental Mutation

Incidental Mutation 'R3611:Rnf17'

269237

Institutional Source

Beutler Lab

Gene Symbol

Rnf17

Ensembl Gene

ENSMUSG00000000365

Gene Name

ring finger protein 17

Synonyms

MMIP-2

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.494) question?

Stock #

R3611 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56640107-56762489 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56705197 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 700 (E700D)

Ref Sequence

ENSEMBL: ENSMUSP00000093469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]

AlphaFold

Q99MV7

Predicted Effect

probably benign
Transcript: ENSMUST00000095793
AA Change: E700D

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: E700D

Domain	Start	End	E-Value	Type
Blast:RING	9	72	2e-15	BLAST
low complexity region	398	405	N/A	INTRINSIC
Pfam:TUDOR	440	522	8.2e-8	PFAM
TUDOR	750	807	4.32e-12	SMART
low complexity region	824	836	N/A	INTRINSIC
Blast:TUDOR	850	882	1e-8	BLAST
low complexity region	959	970	N/A	INTRINSIC
TUDOR	984	1042	1.29e-1	SMART
low complexity region	1128	1139	N/A	INTRINSIC
TUDOR	1245	1301	7.7e-9	SMART
low complexity region	1416	1430	N/A	INTRINSIC
TUDOR	1495	1554	1e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223627

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225621

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	G	A	6: 92,846,965 (GRCm39)	T521M	probably benign	Het
Ap1b1	A	G	11: 4,974,427 (GRCm39)	K345R	possibly damaging	Het
Arhgap26	T	C	18: 39,066,972 (GRCm39)	W53R	probably benign	Het
Brd1	A	G	15: 88,585,147 (GRCm39)	S896P	probably benign	Het
Cc2d2a	A	T	5: 43,869,668 (GRCm39)	E856D	probably damaging	Het
Chd3	A	G	11: 69,252,973 (GRCm39)	S281P	possibly damaging	Het
Chl1	A	G	6: 103,675,116 (GRCm39)	D601G	probably damaging	Het
Cntn3	C	A	6: 102,185,038 (GRCm39)	V693L	possibly damaging	Het
Crygs	C	T	16: 22,624,301 (GRCm39)	G102D	possibly damaging	Het
Dsc2	A	G	18: 20,165,408 (GRCm39)	V855A	probably damaging	Het
Fat2	T	C	11: 55,202,895 (GRCm39)	M60V	probably benign	Het
Fmnl1	A	G	11: 103,085,591 (GRCm39)		probably benign	Het
Gnpda2	A	G	5: 69,734,752 (GRCm39)	S268P	probably benign	Het
Kif18a	A	C	2: 109,168,941 (GRCm39)	D833A	probably benign	Het
Kmt2a	A	T	9: 44,733,763 (GRCm39)		probably benign	Het
Lsg1	A	G	16: 30,380,613 (GRCm39)	V608A	probably benign	Het
Macir	T	C	1: 97,574,059 (GRCm39)	E2G	probably damaging	Het
Mmrn2	G	A	14: 34,120,632 (GRCm39)	V501M	probably benign	Het
Or13a17	G	A	7: 140,271,013 (GRCm39)	C65Y	probably benign	Het
Ppa2	A	G	3: 133,053,867 (GRCm39)	T186A	probably benign	Het
Rims4	T	A	2: 163,721,126 (GRCm39)	I42F	possibly damaging	Het
Skor2	T	C	18: 76,946,533 (GRCm39)	V85A	unknown	Het
Srbd1	T	C	17: 86,410,355 (GRCm39)	T526A	probably benign	Het
Ttn	C	T	2: 76,589,603 (GRCm39)	R21217H	probably damaging	Het
Ubtfl1	T	C	9: 18,320,661 (GRCm39)	I63T	probably damaging	Het
Zfp616	A	G	11: 73,974,268 (GRCm39)	K270R	possibly damaging	Het
Zfp750	G	A	11: 121,402,981 (GRCm39)	P589L	probably benign	Het
Zfr	G	A	15: 12,159,848 (GRCm39)		probably null	Het

Other mutations in Rnf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Rnf17	APN	14	56,658,539 (GRCm39)	missense	probably damaging	0.99
IGL00717:Rnf17	APN	14	56,703,207 (GRCm39)	missense	probably benign	0.00
IGL00978:Rnf17	APN	14	56,749,728 (GRCm39)	missense	probably damaging	1.00
IGL01295:Rnf17	APN	14	56,700,521 (GRCm39)	nonsense	probably null
IGL01779:Rnf17	APN	14	56,699,520 (GRCm39)	missense	probably benign	0.06
IGL02132:Rnf17	APN	14	56,658,623 (GRCm39)	missense	probably benign	0.27
IGL02183:Rnf17	APN	14	56,745,325 (GRCm39)	missense	probably null	0.99
IGL02387:Rnf17	APN	14	56,738,044 (GRCm39)	missense	probably damaging	1.00
IGL02422:Rnf17	APN	14	56,719,592 (GRCm39)	missense	probably damaging	1.00
IGL03081:Rnf17	APN	14	56,671,828 (GRCm39)	missense	probably benign	0.03
IGL03269:Rnf17	APN	14	56,665,403 (GRCm39)	missense	possibly damaging	0.74
divest	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
Shed	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56,708,830 (GRCm39)	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56,708,830 (GRCm39)	missense	probably damaging	1.00
R0089:Rnf17	UTSW	14	56,751,563 (GRCm39)	missense	probably damaging	1.00
R0189:Rnf17	UTSW	14	56,719,650 (GRCm39)	missense	probably null	1.00
R0243:Rnf17	UTSW	14	56,719,541 (GRCm39)	missense	possibly damaging	0.80
R0245:Rnf17	UTSW	14	56,676,066 (GRCm39)	missense	probably damaging	0.97
R0486:Rnf17	UTSW	14	56,751,632 (GRCm39)	missense	probably benign	0.43
R0554:Rnf17	UTSW	14	56,760,007 (GRCm39)	missense	probably damaging	1.00
R0840:Rnf17	UTSW	14	56,712,904 (GRCm39)	missense	probably damaging	1.00
R1169:Rnf17	UTSW	14	56,751,622 (GRCm39)	missense	possibly damaging	0.89
R1170:Rnf17	UTSW	14	56,663,088 (GRCm39)	missense	probably benign	0.10
R1200:Rnf17	UTSW	14	56,705,163 (GRCm39)	missense	probably benign	0.44
R1464:Rnf17	UTSW	14	56,699,368 (GRCm39)	missense	probably damaging	1.00
R1464:Rnf17	UTSW	14	56,699,368 (GRCm39)	missense	probably damaging	1.00
R1472:Rnf17	UTSW	14	56,665,436 (GRCm39)	missense	probably damaging	1.00
R1512:Rnf17	UTSW	14	56,705,243 (GRCm39)	missense	probably benign	0.01
R1605:Rnf17	UTSW	14	56,730,822 (GRCm39)	missense	probably damaging	1.00
R1778:Rnf17	UTSW	14	56,759,856 (GRCm39)	missense	probably damaging	0.99
R1791:Rnf17	UTSW	14	56,741,464 (GRCm39)	nonsense	probably null
R2015:Rnf17	UTSW	14	56,724,426 (GRCm39)	missense	probably benign	0.00
R2023:Rnf17	UTSW	14	56,669,036 (GRCm39)	missense	possibly damaging	0.59
R2086:Rnf17	UTSW	14	56,720,837 (GRCm39)	missense	probably damaging	0.98
R2130:Rnf17	UTSW	14	56,730,811 (GRCm39)	missense	probably damaging	1.00
R2309:Rnf17	UTSW	14	56,743,439 (GRCm39)	missense	possibly damaging	0.95
R3003:Rnf17	UTSW	14	56,738,004 (GRCm39)	missense	probably damaging	1.00
R3847:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3848:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3849:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3850:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3872:Rnf17	UTSW	14	56,712,870 (GRCm39)	missense	possibly damaging	0.89
R3874:Rnf17	UTSW	14	56,712,870 (GRCm39)	missense	possibly damaging	0.89
R4021:Rnf17	UTSW	14	56,697,458 (GRCm39)	missense	probably damaging	0.98
R4022:Rnf17	UTSW	14	56,697,458 (GRCm39)	missense	probably damaging	0.98
R4790:Rnf17	UTSW	14	56,671,812 (GRCm39)	missense	probably damaging	1.00
R4951:Rnf17	UTSW	14	56,759,848 (GRCm39)	missense	probably benign	0.02
R5068:Rnf17	UTSW	14	56,743,385 (GRCm39)	missense	probably damaging	0.99
R5069:Rnf17	UTSW	14	56,743,385 (GRCm39)	missense	probably damaging	0.99
R5070:Rnf17	UTSW	14	56,743,385 (GRCm39)	missense	probably damaging	0.99
R5518:Rnf17	UTSW	14	56,719,590 (GRCm39)	missense	probably damaging	1.00
R5628:Rnf17	UTSW	14	56,724,409 (GRCm39)	splice site	probably null
R5712:Rnf17	UTSW	14	56,708,856 (GRCm39)	missense	probably benign	0.19
R5747:Rnf17	UTSW	14	56,703,276 (GRCm39)	critical splice donor site	probably null
R5869:Rnf17	UTSW	14	56,743,445 (GRCm39)	missense	possibly damaging	0.94
R6336:Rnf17	UTSW	14	56,658,626 (GRCm39)	splice site	probably null
R6626:Rnf17	UTSW	14	56,665,381 (GRCm39)	missense	possibly damaging	0.92
R6639:Rnf17	UTSW	14	56,676,200 (GRCm39)	missense	probably benign	0.01
R6675:Rnf17	UTSW	14	56,697,432 (GRCm39)	missense	probably damaging	1.00
R6731:Rnf17	UTSW	14	56,761,807 (GRCm39)	missense	possibly damaging	0.93
R7062:Rnf17	UTSW	14	56,703,111 (GRCm39)	missense	probably benign	0.00
R7103:Rnf17	UTSW	14	56,708,763 (GRCm39)	missense	possibly damaging	0.63
R7144:Rnf17	UTSW	14	56,749,789 (GRCm39)	splice site	probably null
R7527:Rnf17	UTSW	14	56,753,895 (GRCm39)	missense	probably damaging	1.00
R7664:Rnf17	UTSW	14	56,676,335 (GRCm39)	missense	probably damaging	1.00
R7754:Rnf17	UTSW	14	56,699,529 (GRCm39)	critical splice donor site	probably null
R7772:Rnf17	UTSW	14	56,715,144 (GRCm39)	missense	probably benign	0.27
R8092:Rnf17	UTSW	14	56,724,479 (GRCm39)	missense	probably benign	0.00
R8150:Rnf17	UTSW	14	56,658,593 (GRCm39)	missense	probably benign	0.19
R8203:Rnf17	UTSW	14	56,705,179 (GRCm39)	missense	probably benign	0.17
R8320:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8321:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8379:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8380:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8381:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8382:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8383:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8799:Rnf17	UTSW	14	56,737,886 (GRCm39)	missense	probably damaging	1.00
R8850:Rnf17	UTSW	14	56,722,658 (GRCm39)	missense	probably damaging	1.00
R9212:Rnf17	UTSW	14	56,761,785 (GRCm39)	missense	probably damaging	1.00
R9276:Rnf17	UTSW	14	56,719,554 (GRCm39)	missense	probably damaging	1.00
R9300:Rnf17	UTSW	14	56,697,495 (GRCm39)	missense	possibly damaging	0.79
R9375:Rnf17	UTSW	14	56,719,579 (GRCm39)	missense	probably damaging	1.00
R9664:Rnf17	UTSW	14	56,722,636 (GRCm39)	missense	probably damaging	1.00
Z1177:Rnf17	UTSW	14	56,705,163 (GRCm39)	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- GCTAAATAAGTGGAAACCATGCC -3'
(R):5'- ACTTCCTGTTGTTTATAGTTGCAGC -3'

Sequencing Primer
(F):5'- TGGAAACCATGCCAAGTTATAAG -3'
(R):5'- GTTGCAGCTTCTAAGAAGTTTAAACG -3'

Posted On

2015-02-19