Incidental Mutation 'R3612:Slc9a2'
ID269245
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission 040672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3612 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 40719058 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
Predicted Effect probably null
Transcript: ENSMUST00000027231
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192345
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Meta Mutation Damage Score 0.6432 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,503,187 V192A probably damaging Het
Acsm2 G C 7: 119,591,330 V90L probably damaging Het
Adam5 T C 8: 24,818,089 probably benign Het
Ankrd12 A T 17: 65,983,547 D1630E probably benign Het
Ccdc88c A T 12: 100,939,073 I1085N probably damaging Het
Cdc42bpb A G 12: 111,303,822 probably benign Het
Cdh19 A T 1: 110,893,296 C571S probably damaging Het
Cep290 T A 10: 100,541,581 L1491* probably null Het
Cherp G A 8: 72,461,996 probably benign Het
Diaph3 T C 14: 87,037,457 S188G probably null Het
Ech1 C T 7: 28,830,243 R34C probably damaging Het
Erc2 T C 14: 27,777,177 S337P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fah A G 7: 84,585,290 V412A probably damaging Het
Gatc T A 5: 115,335,486 E131D probably benign Het
Glrb A G 3: 80,862,030 V130A possibly damaging Het
Gm4782 T A 6: 50,608,630 probably null Het
Klhl1 C T 14: 96,381,770 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo15 G C 11: 60,477,679 D422H probably damaging Het
Ncapd3 T A 9: 27,050,357 H360Q probably damaging Het
Olfr381 T C 11: 73,485,940 R295G probably benign Het
Ppargc1b T C 18: 61,310,556 N528S probably benign Het
Rprd2 G A 3: 95,764,152 P1313L probably damaging Het
Slc12a7 C A 13: 73,809,923 D955E probably benign Het
Tex24 T A 8: 27,345,173 V243D probably benign Het
Vmn2r17 A G 5: 109,429,597 T505A probably benign Het
Vps37a T C 8: 40,544,936 probably benign Het
Zmynd19 A G 2: 24,951,480 Y20C probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTTTGGCCTCAGTGACATC -3'
(R):5'- GAGTTTCAAGATCACATCATAAGCTC -3'

Sequencing Primer
(F):5'- GTGACATCACCCTGCTCCAG -3'
(R):5'- TCCAGCAAGATGTGATCTGC -3'
Posted On2015-02-19