Incidental Mutation 'R3612:Tex24'
ID269259
Institutional Source Beutler Lab
Gene Symbol Tex24
Ensembl Gene ENSMUSG00000071138
Gene Nametestis expressed gene 24
SynonymsTESF-1, 1700108N07Rik
MMRRC Submission 040672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3612 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27344394-27349188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27345173 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 243 (V243D)
Ref Sequence ENSEMBL: ENSMUSP00000093021 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000095375
AA Change: V243D

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,503,187 V192A probably damaging Het
Acsm2 G C 7: 119,591,330 V90L probably damaging Het
Adam5 T C 8: 24,818,089 probably benign Het
Ankrd12 A T 17: 65,983,547 D1630E probably benign Het
Ccdc88c A T 12: 100,939,073 I1085N probably damaging Het
Cdc42bpb A G 12: 111,303,822 probably benign Het
Cdh19 A T 1: 110,893,296 C571S probably damaging Het
Cep290 T A 10: 100,541,581 L1491* probably null Het
Cherp G A 8: 72,461,996 probably benign Het
Diaph3 T C 14: 87,037,457 S188G probably null Het
Ech1 C T 7: 28,830,243 R34C probably damaging Het
Erc2 T C 14: 27,777,177 S337P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fah A G 7: 84,585,290 V412A probably damaging Het
Gatc T A 5: 115,335,486 E131D probably benign Het
Glrb A G 3: 80,862,030 V130A possibly damaging Het
Gm4782 T A 6: 50,608,630 probably null Het
Klhl1 C T 14: 96,381,770 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo15 G C 11: 60,477,679 D422H probably damaging Het
Ncapd3 T A 9: 27,050,357 H360Q probably damaging Het
Olfr381 T C 11: 73,485,940 R295G probably benign Het
Ppargc1b T C 18: 61,310,556 N528S probably benign Het
Rprd2 G A 3: 95,764,152 P1313L probably damaging Het
Slc12a7 C A 13: 73,809,923 D955E probably benign Het
Slc9a2 G A 1: 40,719,058 probably null Het
Vmn2r17 A G 5: 109,429,597 T505A probably benign Het
Vps37a T C 8: 40,544,936 probably benign Het
Zmynd19 A G 2: 24,951,480 Y20C probably damaging Het
Other mutations in Tex24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0470:Tex24 UTSW 8 27344908 nonsense probably null
R0744:Tex24 UTSW 8 27344720 missense possibly damaging 0.92
R0836:Tex24 UTSW 8 27344720 missense possibly damaging 0.92
R2260:Tex24 UTSW 8 27344855 missense probably damaging 0.99
R6805:Tex24 UTSW 8 27345000 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGATATCAGACAGCTCCCGAAG -3'
(R):5'- TGAGAGGTCCCAGTCTTCTG -3'

Sequencing Primer
(F):5'- CCCGAAGCAAGAGGTGTTTATTAAC -3'
(R):5'- GAGGTCCCAGTCTTCTGCCTTTG -3'
Posted On2015-02-19