Incidental Mutation 'R3624:Racgap1'
ID269349
Institutional Source Beutler Lab
Gene Symbol Racgap1
Ensembl Gene ENSMUSG00000023015
Gene NameRac GTPase-activating protein 1
SynonymsBand25, gtl11, GTPase, MgcRacGAP
MMRRC Submission 040678-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3624 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99620496-99651656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99642891 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 26 (N26I)
Ref Sequence ENSEMBL: ENSMUSP00000105209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023756] [ENSMUST00000109581] [ENSMUST00000164983] [ENSMUST00000165730] [ENSMUST00000168065] [ENSMUST00000169810] [ENSMUST00000171702] [ENSMUST00000171908]
Predicted Effect probably benign
Transcript: ENSMUST00000023756
AA Change: N26I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023756
Gene: ENSMUSG00000023015
AA Change: N26I

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109581
AA Change: N26I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000164983
AA Change: N26I
Predicted Effect unknown
Transcript: ENSMUST00000165730
AA Change: N26I
Predicted Effect probably benign
Transcript: ENSMUST00000168065
SMART Domains Protein: ENSMUSP00000132732
Gene: ENSMUSG00000023015

DomainStartEndE-ValueType
coiled coil region 6 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169700
Predicted Effect probably benign
Transcript: ENSMUST00000169810
AA Change: N26I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130876
Gene: ENSMUSG00000023015
AA Change: N26I

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171017
Predicted Effect probably benign
Transcript: ENSMUST00000171702
AA Change: N26I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126417
Gene: ENSMUSG00000023015
AA Change: N26I

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171908
AA Change: N26I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128892
Gene: ENSMUSG00000023015
AA Change: N26I

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex. This protein binds activated forms of Rho GTPases and stimulates GTP hydrolysis, which results in negative regulation of Rho-mediated signals. This protein plays a regulatory role in cytokinesis, cell growth, and differentiation. Alternatively spliced transcript variants have been found for this gene. There is a pseudogene for this gene on chromosome 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: Embryos homozygous for a gene-trapped allele exhibit pre-implantation lethality associated with the formation of multinucleated blastomeres and failure to complete cytokinesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adcy2 T C 13: 68,642,531 T905A probably damaging Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Anks1 T C 17: 27,986,288 F274L probably damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
Colec11 T C 12: 28,594,908 M196V probably benign Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emilin3 T C 2: 160,908,257 D477G possibly damaging Het
Esp4 A G 17: 40,602,593 K117R unknown Het
Fam186b A G 15: 99,280,515 L310S probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap C T 4: 56,798,708 V85M possibly damaging Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itih3 A G 14: 30,914,743 Y38H probably damaging Het
Kif21a A G 15: 90,965,595 V35A probably damaging Het
Klhl14 A T 18: 21,557,896 V499D probably damaging Het
Kmt2d T C 15: 98,842,902 probably benign Het
Loxl4 A G 19: 42,607,576 V146A probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad1 A G 8: 79,339,698 V450A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Spag11a A G 8: 19,159,401 D69G probably benign Het
Sptbn1 T C 11: 30,140,593 H559R probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Trim54 G A 5: 31,136,976 V319M possibly damaging Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Uhrf1 C T 17: 56,317,023 T482I probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn1r88 A C 7: 13,177,863 M49L probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zkscan8 C T 13: 21,520,776 R259Q probably damaging Het
Other mutations in Racgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Racgap1 APN 15 99636122 unclassified probably benign
IGL01450:Racgap1 APN 15 99626363 missense probably benign 0.00
IGL01907:Racgap1 APN 15 99626333 nonsense probably null
IGL02584:Racgap1 APN 15 99623634 missense probably benign 0.00
IGL02733:Racgap1 APN 15 99639704 missense probably damaging 1.00
IGL03137:Racgap1 APN 15 99628741 missense probably damaging 0.96
IGL03145:Racgap1 APN 15 99623640 missense probably benign 0.00
IGL02799:Racgap1 UTSW 15 99632747 missense probably benign 0.09
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0140:Racgap1 UTSW 15 99623651 missense probably benign 0.00
R0398:Racgap1 UTSW 15 99628627 splice site probably benign
R0496:Racgap1 UTSW 15 99639832 splice site probably benign
R0528:Racgap1 UTSW 15 99628706 missense probably damaging 1.00
R0893:Racgap1 UTSW 15 99626530 missense probably benign
R0947:Racgap1 UTSW 15 99624314 missense possibly damaging 0.83
R1348:Racgap1 UTSW 15 99626365 missense possibly damaging 0.54
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1720:Racgap1 UTSW 15 99628769 nonsense probably null
R2235:Racgap1 UTSW 15 99626536 missense probably benign
R4621:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4622:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4623:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R5046:Racgap1 UTSW 15 99628762 missense probably damaging 1.00
R5899:Racgap1 UTSW 15 99623628 missense possibly damaging 0.80
R6306:Racgap1 UTSW 15 99623953 missense probably benign
R6513:Racgap1 UTSW 15 99624275 missense probably damaging 1.00
R6618:Racgap1 UTSW 15 99623994 missense probably damaging 0.97
R6953:Racgap1 UTSW 15 99626329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCATAAGCAGCCATCTG -3'
(R):5'- ATTGTCGGCGTGAGATTCTTAC -3'

Sequencing Primer
(F):5'- CTTTTGGACTGCAACACG -3'
(R):5'- CTTACGATGTGGCTGCAGAGAG -3'
Posted On2015-02-19