Incidental Mutation 'R3625:Igsf8'
ID269364
Institutional Source Beutler Lab
Gene Symbol Igsf8
Ensembl Gene ENSMUSG00000038034
Gene Nameimmunoglobulin superfamily, member 8
SynonymsPGRL, KCT-4, ESTM34, EWI-2, PG regulatory-like protein
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172261641-172319841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172317769 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 284 (V284A)
Ref Sequence ENSEMBL: ENSMUSP00000083076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039506] [ENSMUST00000062387] [ENSMUST00000085912] [ENSMUST00000128508] [ENSMUST00000139528] [ENSMUST00000194204] [ENSMUST00000195659]
Predicted Effect probably benign
Transcript: ENSMUST00000039506
AA Change: V284A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041232
Gene: ENSMUSG00000038034
AA Change: V284A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062387
SMART Domains Protein: ENSMUSP00000060110
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 350 3.1e-142 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085912
AA Change: V284A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083076
Gene: ENSMUSG00000038034
AA Change: V284A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128508
SMART Domains Protein: ENSMUSP00000122611
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139528
AA Change: V221A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034
AA Change: V221A

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150598
Predicted Effect probably benign
Transcript: ENSMUST00000194204
SMART Domains Protein: ENSMUSP00000141633
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 361 7.4e-165 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194505
Predicted Effect probably benign
Transcript: ENSMUST00000195659
SMART Domains Protein: ENSMUSP00000141313
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
Blast:IG 1 67 2e-42 BLAST
SCOP:d1nkr_1 6 64 1e-3 SMART
transmembrane domain 74 96 N/A INTRINSIC
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the EWI subfamily of the immunoglobulin protein superfamily. Members of this family contain a single transmembrane domain, an EWI (Glu-Trp-Ile)-motif and a variable number of immunoglobulin domains. This protein interacts with the tetraspanins CD81 and CD9 and may regulate their role in certain cellular functions including cell migration and viral infection. The encoded protein may also function as a tumor suppressor by inhibiting the proliferation of certain cancers. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Igsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Igsf8 APN 1 172317544 missense possibly damaging 0.48
IGL02090:Igsf8 APN 1 172312589 intron probably benign
IGL02523:Igsf8 APN 1 172319413 utr 3 prime probably benign
IGL03092:Igsf8 APN 1 172312529 intron probably benign
IGL03184:Igsf8 APN 1 172318632 missense probably damaging 0.96
R0398:Igsf8 UTSW 1 172317499 missense probably damaging 1.00
R0468:Igsf8 UTSW 1 172318796 missense probably damaging 1.00
R0494:Igsf8 UTSW 1 172318698 missense probably benign 0.06
R0612:Igsf8 UTSW 1 172319407 makesense probably null
R0613:Igsf8 UTSW 1 172317589 missense probably benign 0.00
R0883:Igsf8 UTSW 1 172316259 missense possibly damaging 0.67
R0941:Igsf8 UTSW 1 172316396 missense probably damaging 1.00
R1689:Igsf8 UTSW 1 172318937 missense probably damaging 0.99
R1706:Igsf8 UTSW 1 172317405 missense probably damaging 1.00
R2050:Igsf8 UTSW 1 172318865 missense probably damaging 1.00
R2182:Igsf8 UTSW 1 172290728 critical splice donor site probably null
R3833:Igsf8 UTSW 1 172318270 missense probably benign 0.00
R4674:Igsf8 UTSW 1 172318912 nonsense probably null
R4796:Igsf8 UTSW 1 172316322 missense probably benign 0.07
R6768:Igsf8 UTSW 1 172317532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTAGTGGGACTGCACTC -3'
(R):5'- TCTTTGCAGAAATTTAGAGGCCTC -3'

Sequencing Primer
(F):5'- TGGGACTGCACTCCGACATG -3'
(R):5'- AAATTTAGAGGCCTCTTATATCTCCC -3'
Posted On2015-02-19