Incidental Mutation 'R3625:Mms22l'
ID269367
Institutional Source Beutler Lab
Gene Symbol Mms22l
Ensembl Gene ENSMUSG00000045751
Gene NameMMS22-like, DNA repair protein
SynonymsF730047E07Rik
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location24496451-24602950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24505357 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 206 (S206T)
Ref Sequence ENSEMBL: ENSMUSP00000057715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050446] [ENSMUST00000108222] [ENSMUST00000138567] [ENSMUST00000172622]
Predicted Effect probably damaging
Transcript: ENSMUST00000050446
AA Change: S206T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057715
Gene: ENSMUSG00000045751
AA Change: S206T

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 395 1.1e-199 PFAM
Pfam:MMS22L_N 392 690 4.6e-155 PFAM
low complexity region 698 711 N/A INTRINSIC
low complexity region 761 770 N/A INTRINSIC
Pfam:MMS22L_C 809 1186 2.3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108222
AA Change: S206T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103857
Gene: ENSMUSG00000045751
AA Change: S206T

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 730 N/A PFAM
low complexity region 738 751 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:MMS22L_C 849 1225 1.4e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131282
SMART Domains Protein: ENSMUSP00000133800
Gene: ENSMUSG00000045751

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 459 1.3e-239 PFAM
low complexity region 467 480 N/A INTRINSIC
low complexity region 530 539 N/A INTRINSIC
Pfam:MMS22L_C 578 733 1.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138567
SMART Domains Protein: ENSMUSP00000134736
Gene: ENSMUSG00000045751

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 202 3e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154349
Predicted Effect probably damaging
Transcript: ENSMUST00000172622
AA Change: S134T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133658
Gene: ENSMUSG00000045751
AA Change: S134T

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 204 2.5e-112 PFAM
Pfam:MMS22L_N 202 323 2.2e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173079
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with tonsoku-like, DNA repair protein (TONSL), and this complex recognizes and repairs DNA double-strand breaks at sites of stalled or collapsed replication forks. The encoded protein also can bind with the histone-associated protein NFKBIL2 to help regulate the chromatin state at stalled replication forks. Finally, this gene appears to be overexpressed in most lung and esophageal cancers. Multiple transcript variants exist for this gene, but the full-length nature of only one has been determined to date. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation die prenatally. Heterozygous mice exhibit defects in pinna responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Mms22l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Mms22l APN 4 24502805 missense probably damaging 1.00
IGL02158:Mms22l APN 4 24505349 missense probably damaging 0.98
IGL02533:Mms22l APN 4 24581099 splice site probably benign
IGL02612:Mms22l APN 4 24508482 missense probably benign 0.03
IGL02685:Mms22l APN 4 24591133 missense probably benign
IGL03000:Mms22l APN 4 24581161 missense probably damaging 0.99
IGL03006:Mms22l APN 4 24521253 missense probably damaging 1.00
PIT4280001:Mms22l UTSW 4 24581149 missense probably benign 0.08
R0157:Mms22l UTSW 4 24588224 missense probably damaging 1.00
R0279:Mms22l UTSW 4 24497867 missense probably damaging 1.00
R0669:Mms22l UTSW 4 24517223 missense probably benign 0.00
R1056:Mms22l UTSW 4 24586344 critical splice donor site probably null
R1232:Mms22l UTSW 4 24536274 missense probably benign 0.24
R1389:Mms22l UTSW 4 24591076 missense probably damaging 1.00
R1543:Mms22l UTSW 4 24591084 missense probably benign 0.41
R1604:Mms22l UTSW 4 24502804 missense probably damaging 1.00
R1872:Mms22l UTSW 4 24598807 missense probably damaging 0.99
R1929:Mms22l UTSW 4 24535936 unclassified probably benign
R2024:Mms22l UTSW 4 24588365 missense probably damaging 1.00
R2081:Mms22l UTSW 4 24536150 missense probably damaging 1.00
R2104:Mms22l UTSW 4 24591084 missense probably benign 0.41
R2147:Mms22l UTSW 4 24580063 nonsense probably null
R2379:Mms22l UTSW 4 24496929 missense possibly damaging 0.87
R2496:Mms22l UTSW 4 24521269 missense probably benign 0.31
R3508:Mms22l UTSW 4 24586224 missense probably benign 0.01
R3789:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R4422:Mms22l UTSW 4 24503008 missense probably damaging 1.00
R4623:Mms22l UTSW 4 24502792 nonsense probably null
R4799:Mms22l UTSW 4 24580052 critical splice acceptor site probably null
R4825:Mms22l UTSW 4 24536226 missense probably damaging 1.00
R5236:Mms22l UTSW 4 24588347 missense probably benign 0.02
R5276:Mms22l UTSW 4 24578774 missense probably damaging 1.00
R5364:Mms22l UTSW 4 24496882 unclassified probably benign
R5394:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R6905:Mms22l UTSW 4 24503107 missense probably benign 0.00
R7206:Mms22l UTSW 4 24591146 missense probably benign 0.00
R7290:Mms22l UTSW 4 24517139 missense probably benign
R7425:Mms22l UTSW 4 24596287 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CAGCCATCTCAAGTGTGTGC -3'
(R):5'- AATGATACATGGACACCTTGGG -3'

Sequencing Primer
(F):5'- CTCAAGTGTGTGCCTGTATTAAAC -3'
(R):5'- CATATAATCCAGGGTGGCCTCATG -3'
Posted On2015-02-19