Incidental Mutation 'R3625:Zfp36'
ID269374
Institutional Source Beutler Lab
Gene Symbol Zfp36
Ensembl Gene ENSMUSG00000044786
Gene Namezinc finger protein 36
SynonymsTis11, Ttp, Zfp-36, Tristetraprolin, Nup475
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28376784-28380253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28378256 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 76 (A76S)
Ref Sequence ENSEMBL: ENSMUSP00000146830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051241] [ENSMUST00000209061]
Predicted Effect probably benign
Transcript: ENSMUST00000051241
AA Change: A88S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057815
Gene: ENSMUSG00000044786
AA Change: A88S

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
ZnF_C3H1 95 122 7.54e-10 SMART
ZnF_C3H1 133 160 7.31e-8 SMART
low complexity region 178 222 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208885
Predicted Effect probably benign
Transcript: ENSMUST00000209061
AA Change: A76S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Homozygotes are normal at birth but soon develop myeloid hyperplasia, cachexia, patchy alopecia, dermatitis, arthritis, loss of adiposity, conjunctivitis, glomerular mesangial thickening and autoimmunity, with variable severity. All aspects of the syndrome are normalized by TNF antibody treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Other mutations in Zfp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Zfp36 APN 7 28378463 missense probably damaging 0.99
IGL02094:Zfp36 APN 7 28377763 missense probably benign
R0241:Zfp36 UTSW 7 28378334 missense probably damaging 0.96
R0241:Zfp36 UTSW 7 28378334 missense probably damaging 0.96
R0288:Zfp36 UTSW 7 28378241 missense probably benign
R1941:Zfp36 UTSW 7 28377646 missense probably damaging 0.98
R3744:Zfp36 UTSW 7 28377776 missense probably benign 0.21
R4385:Zfp36 UTSW 7 28377691 missense probably benign 0.11
R5387:Zfp36 UTSW 7 28377868 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAGGTAGAACTTGTGGCAGAGTTC -3'
(R):5'- TCCAGTCGATGAGCCATGAC -3'

Sequencing Primer
(F):5'- GGCAGAGTTCCGTTTTGTAC -3'
(R):5'- AATCCCTCGGAGGACTTTGGAAC -3'
Posted On2015-02-19