Incidental Mutation 'R3625:Yeats4'
ID269383
Institutional Source Beutler Lab
Gene Symbol Yeats4
Ensembl Gene ENSMUSG00000020171
Gene NameYEATS domain containing 4
Synonyms4930573H17Rik, NuBI-1, GAS41, B230215M10Rik
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117215221-117224507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117220368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000020382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020382] [ENSMUST00000218887]
Predicted Effect probably benign
Transcript: ENSMUST00000020382
AA Change: I100V

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020382
Gene: ENSMUSG00000020171
AA Change: I100V

DomainStartEndE-ValueType
Pfam:YEATS 44 124 4.6e-38 PFAM
low complexity region 152 163 N/A INTRINSIC
coiled coil region 178 226 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218027
Predicted Effect probably benign
Transcript: ENSMUST00000218887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219609
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleoli. It has high sequence homology to human MLLT1, and yeast and human MLLT3 proteins. Both MLLT1 and MLLT3 proteins belong to a class of transcription factors, indicating that the encoded protein might also represent a transcription factor. This protein is thought to be required for RNA transcription. This gene has been shown to be amplified in tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Yeats4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Yeats4 APN 10 117215811 missense probably benign 0.01
R0305:Yeats4 UTSW 10 117215836 missense probably damaging 0.99
R1606:Yeats4 UTSW 10 117217439 missense probably damaging 1.00
R1703:Yeats4 UTSW 10 117215723 missense probably benign
R1907:Yeats4 UTSW 10 117215731 missense probably benign 0.17
R3156:Yeats4 UTSW 10 117222281 missense probably benign 0.11
R5687:Yeats4 UTSW 10 117215680 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTATTAGGGACCTGTCTGAG -3'
(R):5'- CGAAAGCTACGGCAATCCTC -3'

Sequencing Primer
(F):5'- GAGTGGCGTTTAAATTGACAGATCC -3'
(R):5'- GCTACGGCAATCCTCTAAGAGGTG -3'
Posted On2015-02-19