Incidental Mutation 'R3625:Rec8'
ID269388
Institutional Source Beutler Lab
Gene Symbol Rec8
Ensembl Gene ENSMUSG00000002324
Gene NameREC8 meiotic recombination protein
Synonymsmrec, Rec8L1
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55618037-55625395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55622497 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 234 (I234T)
Ref Sequence ENSEMBL: ENSMUSP00000002395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002395
AA Change: I234T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324
AA Change: I234T

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126064
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141425
Predicted Effect probably benign
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227922
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are infertile and exhibit small ovaries and testes. Females show absence of ovarian follicles and abnormal meiosis, while males exhibit abnormal chromosome pairing during meiosis, abnormal synaptonemal complex formation, and arrest of male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Rec8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rec8 APN 14 55623515 nonsense probably null
IGL00427:Rec8 APN 14 55618651 missense probably damaging 1.00
IGL02116:Rec8 APN 14 55624879 unclassified probably null
R1349:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1372:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1564:Rec8 UTSW 14 55622275 unclassified probably null
R1667:Rec8 UTSW 14 55618796 missense probably damaging 1.00
R1970:Rec8 UTSW 14 55624142 missense probably damaging 1.00
R3157:Rec8 UTSW 14 55625306 missense probably damaging 0.96
R3919:Rec8 UTSW 14 55621259 missense probably benign 0.02
R4280:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4282:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4283:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4622:Rec8 UTSW 14 55624758 missense probably damaging 1.00
R4894:Rec8 UTSW 14 55625330 missense probably damaging 1.00
R5488:Rec8 UTSW 14 55622826 missense probably benign 0.00
R5489:Rec8 UTSW 14 55622826 missense probably benign 0.00
R6113:Rec8 UTSW 14 55622478 missense probably damaging 0.99
R6264:Rec8 UTSW 14 55619179 missense probably damaging 1.00
R6439:Rec8 UTSW 14 55618619 missense possibly damaging 0.50
Z1088:Rec8 UTSW 14 55625147 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGATTGAAGTGAGTTCCCC -3'
(R):5'- AAACCAGCACCTTCTAGGGC -3'

Sequencing Primer
(F):5'- AGATTGAAGTGAGTTCCCCCATCC -3'
(R):5'- TTCTAGGGCCCGGGGTTC -3'
Posted On2015-02-19