Incidental Mutation 'R3625:Cdh12'
ID269389
Institutional Source Beutler Lab
Gene Symbol Cdh12
Ensembl Gene ENSMUSG00000040452
Gene Namecadherin 12
SynonymsBr-cadherin
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location20449265-21589533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 21358756 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 89 (V89L)
Ref Sequence ENSEMBL: ENSMUSP00000153750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075132] [ENSMUST00000227496]
Predicted Effect probably damaging
Transcript: ENSMUST00000075132
AA Change: V89L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074632
Gene: ENSMUSG00000040452
AA Change: V89L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 77 158 5.18e-18 SMART
CA 182 267 4.4e-30 SMART
CA 291 383 2.42e-18 SMART
CA 406 487 7.55e-20 SMART
CA 510 597 9.3e-2 SMART
transmembrane domain 615 637 N/A INTRINSIC
Pfam:Cadherin_C 640 784 1.7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227496
AA Change: V89L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in both the excitatory and inhibitory neurons in various areas of the adult central nervous system including the cerebellum, neocortex, hippocampus and in different subcortical nuclei. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Cdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Cdh12 APN 15 21237903 missense probably damaging 0.98
IGL01414:Cdh12 APN 15 21492689 missense probably damaging 1.00
IGL02088:Cdh12 APN 15 21480339 nonsense probably null
IGL02894:Cdh12 APN 15 21586294 missense probably damaging 1.00
IGL03008:Cdh12 APN 15 21480330 missense probably damaging 0.98
IGL03271:Cdh12 APN 15 21586453 missense probably benign 0.19
IGL03402:Cdh12 APN 15 21583740 missense probably benign 0.08
R0042:Cdh12 UTSW 15 21537677 splice site probably benign
R0126:Cdh12 UTSW 15 21583945 missense probably benign
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0335:Cdh12 UTSW 15 21578549 critical splice donor site probably null
R0421:Cdh12 UTSW 15 21480224 critical splice acceptor site probably null
R0918:Cdh12 UTSW 15 21492599 missense probably damaging 0.99
R0972:Cdh12 UTSW 15 21237764 missense probably benign 0.27
R1014:Cdh12 UTSW 15 21492620 missense probably damaging 0.97
R1304:Cdh12 UTSW 15 21583937 missense probably benign 0.10
R1677:Cdh12 UTSW 15 21520405 missense probably damaging 0.99
R1735:Cdh12 UTSW 15 21520366 missense probably damaging 1.00
R1916:Cdh12 UTSW 15 21520250 splice site probably null
R1950:Cdh12 UTSW 15 21237879 missense probably damaging 1.00
R2059:Cdh12 UTSW 15 21583740 missense probably benign 0.08
R2157:Cdh12 UTSW 15 21583787 missense possibly damaging 0.84
R2404:Cdh12 UTSW 15 21537634 missense probably damaging 1.00
R3703:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3704:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3743:Cdh12 UTSW 15 21537659 missense probably damaging 0.98
R3771:Cdh12 UTSW 15 21578554 splice site probably benign
R3780:Cdh12 UTSW 15 21585977 splice site probably null
R4750:Cdh12 UTSW 15 21583808 missense possibly damaging 0.59
R5373:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5374:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5443:Cdh12 UTSW 15 21237849 missense probably benign 0.01
R5548:Cdh12 UTSW 15 21492654 missense probably damaging 1.00
R5746:Cdh12 UTSW 15 21358724 missense probably null 1.00
R5960:Cdh12 UTSW 15 21492476 intron probably null
R6248:Cdh12 UTSW 15 21237714 missense possibly damaging 0.82
R6379:Cdh12 UTSW 15 21492657 missense probably benign 0.02
R6419:Cdh12 UTSW 15 21520397 missense probably damaging 0.99
R6561:Cdh12 UTSW 15 21492594 missense probably damaging 1.00
R6901:Cdh12 UTSW 15 21583786 missense probably benign 0.01
R7025:Cdh12 UTSW 15 21358814 missense probably damaging 1.00
R7070:Cdh12 UTSW 15 21583829 missense probably benign 0.38
X0065:Cdh12 UTSW 15 21358765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGAGTTAAGGGTGCATTC -3'
(R):5'- CCCACAGGAGACATTTCTGG -3'

Sequencing Primer
(F):5'- AGGGTGCATTCTGAATTATCCAGC -3'
(R):5'- CAGGAGACATTTCTGGAACACTAGC -3'
Posted On2015-02-19