Incidental Mutation 'R3625:Atg3'
ID269392
Institutional Source Beutler Lab
Gene Symbol Atg3
Ensembl Gene ENSMUSG00000022663
Gene Nameautophagy related 3
SynonymsPC3-96, 2610016C12Rik, Apg3l, APG3
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45158785-45188538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45175261 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 119 (I119N)
Ref Sequence ENSEMBL: ENSMUSP00000023343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023343]
Predicted Effect probably benign
Transcript: ENSMUST00000023343
AA Change: I119N

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023343
Gene: ENSMUSG00000022663
AA Change: I119N

DomainStartEndE-ValueType
Pfam:Autophagy_N 8 153 1.4e-55 PFAM
Pfam:Autophagy_act_C 204 265 8.8e-23 PFAM
Pfam:Autophagy_C 286 310 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150390
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like-conjugating enzyme and is a component of ubiquitination-like systems involved in autophagy, the process of degradation, turnover and recycling of cytoplasmic constituents in eukaryotic cells. This protein is known to play a role in regulation of autophagy during cell death. A pseudogene of this gene is located on chromosome 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit decreased autophagy, decreased T cell proliferation, and increased T cell apoptosis. Mice homozygous for a knock-out allele exhibit decreased birth weight, neonatal lethality and abnormal autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Atg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Atg3 APN 16 45183811 critical splice donor site probably null
IGL01298:Atg3 APN 16 45171673 missense possibly damaging 0.78
IGL02285:Atg3 APN 16 45178317 splice site probably benign
IGL02626:Atg3 APN 16 45183685 missense probably benign 0.04
R1494:Atg3 UTSW 16 45171760 splice site probably benign
R3743:Atg3 UTSW 16 45178228 critical splice acceptor site probably null
R5047:Atg3 UTSW 16 45178232 missense probably benign 0.00
R5235:Atg3 UTSW 16 45159157 missense probably benign 0.15
R6696:Atg3 UTSW 16 45175281 missense possibly damaging 0.93
R7276:Atg3 UTSW 16 45162442 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGTCATGGTGATATAGATACGTTGC -3'
(R):5'- TTACTGTCCAGTGGAGTTACAC -3'

Sequencing Primer
(F):5'- TGAGGCATATTTTTGGAGGTACC -3'
(R):5'- ACCTGAATTCTATCTGCTGGG -3'
Posted On2015-02-19