Incidental Mutation 'R3625:Map3k8'
ID269396
Institutional Source Beutler Lab
Gene Symbol Map3k8
Ensembl Gene ENSMUSG00000024235
Gene Namemitogen-activated protein kinase kinase kinase 8
SynonymsTpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location4331327-4353015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4333965 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 376 (R376C)
Ref Sequence ENSEMBL: ENSMUSP00000025078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025078] [ENSMUST00000173930]
Predicted Effect probably damaging
Transcript: ENSMUST00000025078
AA Change: R376C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: R376C

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173708
Predicted Effect probably benign
Transcript: ENSMUST00000173930
SMART Domains Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235

DomainStartEndE-ValueType
SCOP:d1phk__ 146 169 2e-4 SMART
Meta Mutation Damage Score 0.684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Map3k8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime probably benign
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense possibly damaging 0.95
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
juicy UTSW 18 4339552 missense probably damaging 0.99
Sluggish UTSW 18 4339608 splice site probably benign
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
R6317:Map3k8 UTSW 18 4348979 critical splice donor site probably null
R6326:Map3k8 UTSW 18 4340651 missense probably damaging 1.00
R6910:Map3k8 UTSW 18 4340801 missense probably benign 0.03
R7010:Map3k8 UTSW 18 4334060 missense probably damaging 1.00
R7247:Map3k8 UTSW 18 4334036 missense probably damaging 1.00
R7300:Map3k8 UTSW 18 4349076 missense probably damaging 0.98
R7348:Map3k8 UTSW 18 4340561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGAGCTTTGCTGTAGACAG -3'
(R):5'- AATAGGTCTCTCCCCTAGCC -3'

Sequencing Primer
(F):5'- TGGCTCCACACCCACAGG -3'
(R):5'- TAGCCTTTCCTGCAGAAGATATACC -3'
Posted On2015-02-19