Incidental Mutation 'R3683:Stat4'
ID269402
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Namesignal transducer and activator of transcription 4
Synonyms
MMRRC Submission 040681-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R3683 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location51987148-52107189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52013822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 54 (T54I)
Ref Sequence ENSEMBL: ENSMUSP00000130713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027277
AA Change: T54I

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: T54I

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168302
AA Change: T54I

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: T54I

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187053
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik T C X: 81,420,235 D622G possibly damaging Het
Acad11 T C 9: 104,115,344 I495T probably damaging Het
Acat1 C T 9: 53,587,465 A307T probably damaging Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Bmp2 T A 2: 133,554,472 V16D probably benign Het
Cables2 G A 2: 180,264,470 R121* probably null Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Csrnp2 A T 15: 100,481,998 S471T probably benign Het
Dnah7a C A 1: 53,444,516 M3367I probably benign Het
Elp4 A T 2: 105,702,761 M413K possibly damaging Het
Fat1 A G 8: 45,017,938 D1593G probably benign Het
Fbxw24 G A 9: 109,608,042 P259L possibly damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gm14124 A G 2: 150,268,056 K222R probably benign Het
Klra9 T C 6: 130,191,297 N2S probably benign Het
Lama1 A G 17: 67,768,333 D1015G probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nrxn1 T C 17: 90,623,452 D779G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Olfr709-ps1 G A 7: 106,927,094 R122* probably null Het
Osmr A C 15: 6,837,053 V380G possibly damaging Het
Phf21b A G 15: 84,798,690 I222T probably damaging Het
Ptprq G T 10: 107,708,628 T347K probably benign Het
Sema6d G T 2: 124,654,226 L63F possibly damaging Het
Serpinb9b C T 13: 33,029,598 A46V probably damaging Het
Sf3b3 A G 8: 110,813,621 probably null Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tbc1d20 C T 2: 152,311,817 T354I probably benign Het
Tbc1d31 T C 15: 57,951,814 probably null Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Utrn A G 10: 12,666,835 M1802T probably benign Het
Vmn1r8 A C 6: 57,036,275 T104P probably damaging Het
Vmn2r13 C A 5: 109,156,855 R570I probably damaging Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Zmpste24 A G 4: 121,061,091 F445L probably damaging Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52102878 missense probably damaging 1.00
IGL00482:Stat4 APN 1 52074697 missense probably benign 0.05
IGL01395:Stat4 APN 1 52011874 missense probably damaging 1.00
IGL01533:Stat4 APN 1 52098419 missense probably damaging 1.00
IGL01943:Stat4 APN 1 52096855 missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52102865 missense probably damaging 1.00
IGL02151:Stat4 APN 1 52013870 missense probably damaging 0.99
IGL02601:Stat4 APN 1 52098415 missense probably damaging 1.00
R0016:Stat4 UTSW 1 52068780 missense probably benign 0.01
R0243:Stat4 UTSW 1 52011857 missense probably benign 0.22
R0329:Stat4 UTSW 1 52090870 intron probably benign
R0973:Stat4 UTSW 1 52096820 missense probably damaging 0.99
R1144:Stat4 UTSW 1 52084129 splice site probably benign
R1187:Stat4 UTSW 1 52076677 missense probably damaging 1.00
R1331:Stat4 UTSW 1 52013927 missense probably benign 0.20
R1401:Stat4 UTSW 1 52071947 splice site probably benign
R1529:Stat4 UTSW 1 52011793 missense probably damaging 1.00
R1711:Stat4 UTSW 1 52106925 missense probably damaging 1.00
R2213:Stat4 UTSW 1 52013855 missense probably damaging 0.98
R3003:Stat4 UTSW 1 52102986 missense probably damaging 1.00
R3789:Stat4 UTSW 1 52011796 missense probably benign 0.07
R3919:Stat4 UTSW 1 52096822 missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52074707 missense probably benign
R4373:Stat4 UTSW 1 52071941 critical splice donor site probably null
R5024:Stat4 UTSW 1 52082570 missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52071895 missense probably damaging 0.97
R5206:Stat4 UTSW 1 52105236 missense probably damaging 0.99
R5944:Stat4 UTSW 1 52074739 missense probably damaging 1.00
R5961:Stat4 UTSW 1 52065384 missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52096867 missense probably damaging 0.96
R6161:Stat4 UTSW 1 52074677 missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52102201 missense probably null 1.00
R6701:Stat4 UTSW 1 52102974 missense probably damaging 1.00
R6767:Stat4 UTSW 1 52076583 missense probably benign 0.00
R6989:Stat4 UTSW 1 52068815 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCTAATGATGTTGAACAGCTTTTC -3'
(R):5'- AGCTGGTCTTATTTATTTCCATGGC -3'

Sequencing Primer
(F):5'- GATGTTGAACAGCTTTTCATGTATTC -3'
(R):5'- ATTTCCATGGCATTGAACTTGG -3'
Posted On2015-02-19