Incidental Mutation 'R3684:Lct'
ID 269455
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Name lactase
Synonyms LPH, LOC226413, Lphl
MMRRC Submission 040682-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3684 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 128212493-128256055 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128231963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 629 (M629V)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
AlphaFold F8VPT3
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: M629V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: M629V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Meta Mutation Damage Score 0.3962 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C T 14: 68,819,447 (GRCm39) V17I probably benign Het
Ahdc1 T C 4: 132,793,013 (GRCm39) L1418P possibly damaging Het
Atr T C 9: 95,802,453 (GRCm39) S1782P probably damaging Het
Btbd9 T A 17: 30,553,281 (GRCm39) N394Y probably damaging Het
Calb2 A G 8: 110,883,620 (GRCm39) Y35H probably benign Het
Cdon A G 9: 35,400,328 (GRCm39) E1014G possibly damaging Het
Cep83 A G 10: 94,622,687 (GRCm39) T588A probably benign Het
Cfap126 T C 1: 170,941,600 (GRCm39) S32P possibly damaging Het
Clcn7 T C 17: 25,369,567 (GRCm39) L301P possibly damaging Het
Corin T C 5: 72,488,198 (GRCm39) D610G probably damaging Het
Dok3 A G 13: 55,672,306 (GRCm39) S154P probably damaging Het
Ggta1 T A 2: 35,298,000 (GRCm39) T162S probably benign Het
Gldn G A 9: 54,245,624 (GRCm39) E392K possibly damaging Het
Gls A T 1: 52,205,452 (GRCm39) D447E probably damaging Het
Itih5 A T 2: 10,243,435 (GRCm39) N391Y possibly damaging Het
Jchain G A 5: 88,670,398 (GRCm39) P74S probably damaging Het
Lrrn1 T C 6: 107,544,910 (GRCm39) V236A probably benign Het
Mcm3ap T C 10: 76,325,260 (GRCm39) S954P possibly damaging Het
Myh11 T C 16: 14,021,098 (GRCm39) N1725S probably benign Het
Ppcdc C T 9: 57,328,408 (GRCm39) probably null Het
Rhobtb3 A G 13: 76,087,600 (GRCm39) I129T probably damaging Het
Sfxn2 A G 19: 46,579,592 (GRCm39) R252G probably benign Het
Sh2d2a C A 3: 87,759,027 (GRCm39) probably null Het
Sh3gl1 T C 17: 56,325,953 (GRCm39) K159E possibly damaging Het
Slc7a9 A G 7: 35,152,926 (GRCm39) T115A probably benign Het
Spmap1 A T 11: 97,666,525 (GRCm39) Y54N probably damaging Het
Synj2 A T 17: 6,078,718 (GRCm39) D1020V probably damaging Het
Tenm2 C A 11: 35,942,644 (GRCm39) V1342L probably benign Het
Tmem127 T A 2: 127,090,652 (GRCm39) I56N possibly damaging Het
Traj7 A G 14: 54,448,938 (GRCm39) probably benign Het
Unc5d A G 8: 29,184,620 (GRCm39) F627L probably damaging Het
Unc79 T A 12: 103,041,062 (GRCm39) N698K probably benign Het
Usp17la A T 7: 104,510,937 (GRCm39) N514I possibly damaging Het
Uvrag A T 7: 98,637,427 (GRCm39) C341S probably damaging Het
Zfp810 T C 9: 22,189,531 (GRCm39) D459G probably benign Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128,215,293 (GRCm39) missense probably benign 0.09
IGL00970:Lct APN 1 128,231,805 (GRCm39) missense probably damaging 1.00
IGL01022:Lct APN 1 128,228,596 (GRCm39) missense probably benign
IGL01878:Lct APN 1 128,222,003 (GRCm39) missense probably damaging 1.00
IGL01892:Lct APN 1 128,235,342 (GRCm39) missense probably damaging 1.00
IGL02307:Lct APN 1 128,214,327 (GRCm39) missense possibly damaging 0.70
IGL02434:Lct APN 1 128,231,527 (GRCm39) missense probably damaging 0.97
IGL02559:Lct APN 1 128,222,003 (GRCm39) missense probably damaging 1.00
IGL02623:Lct APN 1 128,235,988 (GRCm39) missense probably benign 0.01
IGL02818:Lct APN 1 128,227,905 (GRCm39) missense probably damaging 1.00
IGL02949:Lct APN 1 128,240,869 (GRCm39) missense probably benign 0.26
IGL02951:Lct APN 1 128,227,948 (GRCm39) missense probably damaging 1.00
IGL03087:Lct APN 1 128,228,112 (GRCm39) missense possibly damaging 0.81
IGL03227:Lct APN 1 128,255,426 (GRCm39) missense probably benign 0.09
ANU18:Lct UTSW 1 128,235,784 (GRCm39) nonsense probably null
R0071:Lct UTSW 1 128,219,755 (GRCm39) nonsense probably null
R0071:Lct UTSW 1 128,219,755 (GRCm39) nonsense probably null
R0135:Lct UTSW 1 128,212,860 (GRCm39) missense probably damaging 0.98
R0145:Lct UTSW 1 128,255,632 (GRCm39) missense probably benign 0.00
R0179:Lct UTSW 1 128,255,422 (GRCm39) missense probably benign
R0331:Lct UTSW 1 128,226,479 (GRCm39) splice site probably benign
R0366:Lct UTSW 1 128,214,199 (GRCm39) missense probably benign 0.03
R0399:Lct UTSW 1 128,228,262 (GRCm39) missense probably damaging 1.00
R0492:Lct UTSW 1 128,228,319 (GRCm39) missense probably damaging 1.00
R0548:Lct UTSW 1 128,212,932 (GRCm39) missense probably damaging 1.00
R0691:Lct UTSW 1 128,235,971 (GRCm39) missense probably benign 0.00
R0755:Lct UTSW 1 128,221,872 (GRCm39) missense possibly damaging 0.46
R0839:Lct UTSW 1 128,214,346 (GRCm39) missense probably benign 0.00
R1128:Lct UTSW 1 128,229,046 (GRCm39) missense probably damaging 0.99
R1135:Lct UTSW 1 128,221,861 (GRCm39) critical splice donor site probably null
R1321:Lct UTSW 1 128,227,759 (GRCm39) missense probably benign
R1448:Lct UTSW 1 128,235,559 (GRCm39) missense probably damaging 0.99
R1450:Lct UTSW 1 128,235,640 (GRCm39) missense probably damaging 1.00
R1572:Lct UTSW 1 128,221,932 (GRCm39) missense probably benign 0.25
R1582:Lct UTSW 1 128,228,299 (GRCm39) missense probably damaging 1.00
R1668:Lct UTSW 1 128,215,459 (GRCm39) splice site probably null
R1757:Lct UTSW 1 128,228,994 (GRCm39) missense probably damaging 1.00
R1775:Lct UTSW 1 128,228,038 (GRCm39) missense probably damaging 1.00
R1792:Lct UTSW 1 128,255,679 (GRCm39) missense possibly damaging 0.54
R1815:Lct UTSW 1 128,227,896 (GRCm39) missense probably damaging 1.00
R1932:Lct UTSW 1 128,221,898 (GRCm39) missense probably damaging 1.00
R2325:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R2381:Lct UTSW 1 128,231,858 (GRCm39) nonsense probably null
R3001:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3002:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3003:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3011:Lct UTSW 1 128,229,109 (GRCm39) missense possibly damaging 0.74
R3082:Lct UTSW 1 128,215,345 (GRCm39) missense probably damaging 1.00
R3683:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3726:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3886:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3887:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3888:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4019:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4027:Lct UTSW 1 128,212,918 (GRCm39) missense probably benign 0.00
R4226:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4409:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4514:Lct UTSW 1 128,228,251 (GRCm39) missense probably benign
R4570:Lct UTSW 1 128,227,641 (GRCm39) missense probably benign 0.01
R4776:Lct UTSW 1 128,228,124 (GRCm39) missense probably damaging 0.99
R5001:Lct UTSW 1 128,235,978 (GRCm39) missense probably damaging 0.96
R5021:Lct UTSW 1 128,228,302 (GRCm39) missense probably benign 0.38
R5318:Lct UTSW 1 128,232,109 (GRCm39) missense probably damaging 1.00
R5330:Lct UTSW 1 128,226,266 (GRCm39) missense probably benign 0.06
R5385:Lct UTSW 1 128,239,354 (GRCm39) missense possibly damaging 0.63
R5499:Lct UTSW 1 128,214,414 (GRCm39) missense probably damaging 1.00
R5508:Lct UTSW 1 128,221,868 (GRCm39) missense probably damaging 1.00
R5642:Lct UTSW 1 128,222,969 (GRCm39) missense probably damaging 1.00
R5724:Lct UTSW 1 128,228,073 (GRCm39) missense probably benign
R6026:Lct UTSW 1 128,227,755 (GRCm39) missense probably benign
R6044:Lct UTSW 1 128,235,717 (GRCm39) missense possibly damaging 0.95
R6175:Lct UTSW 1 128,255,451 (GRCm39) missense probably damaging 1.00
R6277:Lct UTSW 1 128,231,974 (GRCm39) missense probably benign 0.01
R6412:Lct UTSW 1 128,255,455 (GRCm39) missense probably benign 0.00
R6480:Lct UTSW 1 128,222,057 (GRCm39) missense probably damaging 1.00
R6526:Lct UTSW 1 128,228,215 (GRCm39) missense probably benign 0.05
R6620:Lct UTSW 1 128,222,809 (GRCm39) critical splice donor site probably null
R7214:Lct UTSW 1 128,228,197 (GRCm39) missense probably benign 0.00
R7308:Lct UTSW 1 128,246,824 (GRCm39) missense probably benign 0.00
R7577:Lct UTSW 1 128,228,469 (GRCm39) missense probably damaging 0.99
R7626:Lct UTSW 1 128,212,932 (GRCm39) missense probably damaging 1.00
R7737:Lct UTSW 1 128,226,430 (GRCm39) missense probably benign 0.12
R7901:Lct UTSW 1 128,216,722 (GRCm39) missense probably benign 0.44
R8033:Lct UTSW 1 128,212,996 (GRCm39) missense probably benign 0.03
R8373:Lct UTSW 1 128,231,577 (GRCm39) missense probably damaging 1.00
R8504:Lct UTSW 1 128,215,306 (GRCm39) missense probably damaging 1.00
R8751:Lct UTSW 1 128,221,534 (GRCm39) missense probably benign 0.18
R8781:Lct UTSW 1 128,215,261 (GRCm39) missense probably damaging 1.00
R8797:Lct UTSW 1 128,231,684 (GRCm39) missense possibly damaging 0.77
R8926:Lct UTSW 1 128,228,148 (GRCm39) missense probably damaging 1.00
R8949:Lct UTSW 1 128,221,929 (GRCm39) missense probably damaging 1.00
R8992:Lct UTSW 1 128,228,299 (GRCm39) missense probably damaging 1.00
R9138:Lct UTSW 1 128,227,894 (GRCm39) missense probably benign 0.03
R9260:Lct UTSW 1 128,227,704 (GRCm39) nonsense probably null
R9416:Lct UTSW 1 128,228,329 (GRCm39) missense possibly damaging 0.74
R9531:Lct UTSW 1 128,235,598 (GRCm39) missense probably benign 0.00
X0052:Lct UTSW 1 128,235,367 (GRCm39) missense probably damaging 1.00
YA93:Lct UTSW 1 128,229,057 (GRCm39) missense probably damaging 1.00
Z1176:Lct UTSW 1 128,215,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTAGGAAATCCGCAGAGC -3'
(R):5'- GAACTTGGGAACAGTGACTTG -3'

Sequencing Primer
(F):5'- TAGGAAATCCGCAGAGCCTTTCAG -3'
(R):5'- GAACAGTGACTTGATAGTGTCTCTC -3'
Posted On 2015-02-19