Incidental Mutation 'R3684:1700001P01Rik'
List |< first << previous [record 61 of 55675] next >> last >|
ID269480
Institutional Source Beutler Lab
Gene Symbol 1700001P01Rik
Ensembl Gene ENSMUSG00000018543
Gene NameRIKEN cDNA 1700001P01 gene
Synonyms
MMRRC Submission 040682-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R3684 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97771481-97775918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97775699 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 54 (Y54N)
Ref Sequence ENSEMBL: ENSMUSP00000103202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103146] [ENSMUST00000107576]
Predicted Effect probably benign
Transcript: ENSMUST00000103146
SMART Domains Protein: ENSMUSP00000099435
Gene: ENSMUSG00000071415

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Ribosomal_L14 19 140 2.71e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107576
AA Change: Y54N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103202
Gene: ENSMUSG00000018543
AA Change: Y54N

DomainStartEndE-ValueType
Pfam:DUF4542 12 146 5.8e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183504
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C T 14: 68,581,998 V17I probably benign Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atr T C 9: 95,920,400 S1782P probably damaging Het
Btbd9 T A 17: 30,334,307 N394Y probably damaging Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cep83 A G 10: 94,786,825 T588A probably benign Het
Cfap126 T C 1: 171,114,031 S32P possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Dok3 A G 13: 55,524,493 S154P probably damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gls A T 1: 52,166,293 D447E probably damaging Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Jchain G A 5: 88,522,539 P74S probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrrn1 T C 6: 107,567,949 V236A probably benign Het
Mcm3ap T C 10: 76,489,426 S954P possibly damaging Het
Myh11 T C 16: 14,203,234 N1725S probably benign Het
Ppcdc C T 9: 57,421,125 probably null Het
Rhobtb3 A G 13: 75,939,481 I129T probably damaging Het
Sfxn2 A G 19: 46,591,153 R252G probably benign Het
Sh2d2a C A 3: 87,851,720 probably null Het
Sh3gl1 T C 17: 56,018,953 K159E possibly damaging Het
Slc7a9 A G 7: 35,453,501 T115A probably benign Het
Synj2 A T 17: 6,028,443 D1020V probably damaging Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Tmem127 T A 2: 127,248,732 I56N possibly damaging Het
Traj7 A G 14: 54,211,481 probably benign Het
Unc5d A G 8: 28,694,592 F627L probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Usp17la A T 7: 104,861,730 N514I possibly damaging Het
Uvrag A T 7: 98,988,220 C341S probably damaging Het
Zfp810 T C 9: 22,278,235 D459G probably benign Het
Other mutations in 1700001P01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:1700001P01Rik APN 11 97771581 missense probably damaging 0.97
IGL02372:1700001P01Rik APN 11 97775699 missense probably damaging 1.00
R1720:1700001P01Rik UTSW 11 97771609 missense probably damaging 1.00
R4592:1700001P01Rik UTSW 11 97771615 missense probably damaging 1.00
R5250:1700001P01Rik UTSW 11 97772727 missense possibly damaging 0.92
X0020:1700001P01Rik UTSW 11 97775663 nonsense probably null
X0063:1700001P01Rik UTSW 11 97775805 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCTCGCAGAAACAAGAAATG -3'
(R):5'- GCTCCAGAAAGCTCTCAGAC -3'

Sequencing Primer
(F):5'- AGGACCAAATGAGCTCAGC -3'
(R):5'- TCTCAGACTCGAAGACTGCG -3'
Posted On2015-02-19