Incidental Mutation 'R3685:Or4c118'
ID 269496
Institutional Source Beutler Lab
Gene Symbol Or4c118
Ensembl Gene ENSMUSG00000075100
Gene Name olfactory receptor family 4 subfamily C member 118
Synonyms MOR233-10, Olfr1223, GA_x6K02T2Q125-50623664-50622729
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R3685 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 88974430-88981680 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 88975364 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000150550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099793] [ENSMUST00000217342]
AlphaFold A0A1L1SU13
Predicted Effect probably null
Transcript: ENSMUST00000099793
AA Change: M1K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097381
Gene: ENSMUSG00000075099
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2e-26 PFAM
Pfam:7tm_4 138 283 5.6e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111554
AA Change: M1K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107179
Gene: ENSMUSG00000075100
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.1e-48 PFAM
Pfam:7tm_1 39 286 1.6e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217342
AA Change: M1K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 132,793,013 (GRCm39) L1418P possibly damaging Het
Atp13a5 G C 16: 29,135,573 (GRCm39) L340V probably damaging Het
Cdon A G 9: 35,400,328 (GRCm39) E1014G possibly damaging Het
Cyp2c40 A G 19: 39,775,223 (GRCm39) M343T possibly damaging Het
Dmrtc2 T C 7: 24,573,687 (GRCm39) V174A probably benign Het
Ggta1 T A 2: 35,298,000 (GRCm39) T162S probably benign Het
Gm9637 A G 14: 19,401,950 (GRCm38) noncoding transcript Het
Gpbp1 T C 13: 111,603,405 (GRCm39) T15A probably benign Het
Itih5 A T 2: 10,243,435 (GRCm39) N391Y possibly damaging Het
Klhl40 A G 9: 121,611,724 (GRCm39) E579G probably damaging Het
Or4a73 C A 2: 89,421,099 (GRCm39) R120L probably damaging Het
Or5d37 T A 2: 87,923,603 (GRCm39) I226F probably damaging Het
Prr16 C A 18: 51,435,892 (GRCm39) P124T probably damaging Het
Ribc2 A G 15: 85,019,535 (GRCm39) T106A possibly damaging Het
Slc37a1 C A 17: 31,544,667 (GRCm39) T253N probably benign Het
Smpd1 T A 7: 105,204,609 (GRCm39) C163S probably damaging Het
Tacc2 A G 7: 130,226,800 (GRCm39) S1162G probably benign Het
Tenm2 C A 11: 35,942,644 (GRCm39) V1342L probably benign Het
Trim34a T C 7: 103,909,333 (GRCm39) probably null Het
Zfand6 G A 7: 84,283,570 (GRCm39) P11S probably damaging Het
Other mutations in Or4c118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Or4c118 APN 2 88,974,575 (GRCm39) missense possibly damaging 0.55
IGL01560:Or4c118 APN 2 88,974,947 (GRCm39) missense probably damaging 1.00
IGL01817:Or4c118 APN 2 88,974,702 (GRCm39) missense probably benign 0.01
IGL02669:Or4c118 APN 2 88,974,564 (GRCm39) nonsense probably null
IGL03270:Or4c118 APN 2 88,975,089 (GRCm39) missense probably damaging 0.98
R0062:Or4c118 UTSW 2 88,974,966 (GRCm39) missense possibly damaging 0.95
R0062:Or4c118 UTSW 2 88,974,966 (GRCm39) missense possibly damaging 0.95
R0304:Or4c118 UTSW 2 88,975,108 (GRCm39) nonsense probably null
R1651:Or4c118 UTSW 2 88,975,346 (GRCm39) missense probably damaging 1.00
R1971:Or4c118 UTSW 2 88,975,078 (GRCm39) nonsense probably null
R2006:Or4c118 UTSW 2 88,975,241 (GRCm39) missense probably benign 0.21
R2101:Or4c118 UTSW 2 88,975,301 (GRCm39) missense probably benign 0.03
R2410:Or4c118 UTSW 2 88,974,899 (GRCm39) missense possibly damaging 0.88
R3683:Or4c118 UTSW 2 88,975,364 (GRCm39) start codon destroyed probably null 1.00
R3939:Or4c118 UTSW 2 88,974,474 (GRCm39) nonsense probably null
R6162:Or4c118 UTSW 2 88,975,114 (GRCm39) missense probably benign 0.00
R8431:Or4c118 UTSW 2 88,974,723 (GRCm39) missense probably benign 0.06
R8842:Or4c118 UTSW 2 88,975,074 (GRCm39) missense probably benign
R9631:Or4c118 UTSW 2 88,975,522 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCATGCATCCAGGAATGAAAG -3'
(R):5'- AGTCATCCTGTGCCCTTTGG -3'

Sequencing Primer
(F):5'- CATGCATCCAGGAATGAAAGGAAAG -3'
(R):5'- GTGCCCTTTGGTCTGCGTC -3'
Posted On 2015-02-19