Incidental Mutation 'R3685:Gpbp1'
ID269507
Institutional Source Beutler Lab
Gene Symbol Gpbp1
Ensembl Gene ENSMUSG00000032745
Gene NameGC-rich promoter binding protein 1
Synonyms1700034P14Rik, D230035M11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3685 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location111425680-111490111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111466871 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 15 (T15A)
Ref Sequence ENSEMBL: ENSMUSP00000088777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047627] [ENSMUST00000091236] [ENSMUST00000136471] [ENSMUST00000231096]
Predicted Effect probably benign
Transcript: ENSMUST00000047627
AA Change: T15A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048240
Gene: ENSMUSG00000032745
AA Change: T15A

DomainStartEndE-ValueType
low complexity region 232 243 N/A INTRINSIC
Pfam:Vasculin 395 491 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091236
AA Change: T15A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088777
Gene: ENSMUSG00000032745
AA Change: T15A

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
Pfam:Vasculin 374 471 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136471
AA Change: T15A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000231096
AA Change: T15A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atp13a5 G C 16: 29,316,755 L340V probably damaging Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cyp2c40 A G 19: 39,786,779 M343T possibly damaging Het
Dmrtc2 T C 7: 24,874,262 V174A probably benign Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gm9637 A G 14: 19,401,950 noncoding transcript Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Klhl40 A G 9: 121,782,658 E579G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Prr16 C A 18: 51,302,820 P124T probably damaging Het
Ribc2 A G 15: 85,135,334 T106A possibly damaging Het
Slc37a1 C A 17: 31,325,693 T253N probably benign Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Trim34a T C 7: 104,260,126 probably null Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Other mutations in Gpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gpbp1 APN 13 111440750 missense probably damaging 0.96
IGL01360:Gpbp1 APN 13 111426541 utr 3 prime probably benign
IGL01609:Gpbp1 APN 13 111439202 missense possibly damaging 0.62
IGL01747:Gpbp1 APN 13 111453050 missense probably damaging 0.99
IGL02614:Gpbp1 APN 13 111436473 missense probably benign 0.01
IGL03329:Gpbp1 APN 13 111453253 splice site probably benign
R0315:Gpbp1 UTSW 13 111436538 missense possibly damaging 0.50
R0510:Gpbp1 UTSW 13 111440745 missense possibly damaging 0.58
R1549:Gpbp1 UTSW 13 111436579 missense probably benign 0.00
R1582:Gpbp1 UTSW 13 111436532 unclassified probably null
R1762:Gpbp1 UTSW 13 111440774 missense probably benign 0.02
R2074:Gpbp1 UTSW 13 111453407 missense probably benign 0.18
R2276:Gpbp1 UTSW 13 111466978 splice site probably null
R4307:Gpbp1 UTSW 13 111448983 makesense probably null
R4408:Gpbp1 UTSW 13 111448964 missense possibly damaging 0.63
R4840:Gpbp1 UTSW 13 111440630 critical splice donor site probably null
R4952:Gpbp1 UTSW 13 111440750 missense probably damaging 0.96
R5152:Gpbp1 UTSW 13 111453281 intron probably benign
R5376:Gpbp1 UTSW 13 111426642 missense probably damaging 1.00
R6143:Gpbp1 UTSW 13 111466855 missense probably damaging 0.98
R6378:Gpbp1 UTSW 13 111433612 missense probably damaging 1.00
R6516:Gpbp1 UTSW 13 111453102 missense probably benign 0.05
R6687:Gpbp1 UTSW 13 111438085 missense possibly damaging 0.78
R6745:Gpbp1 UTSW 13 111453385 missense probably benign 0.05
R7186:Gpbp1 UTSW 13 111440699 missense possibly damaging 0.89
R7310:Gpbp1 UTSW 13 111453390 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACAGGCCTTACACAGGTGA -3'
(R):5'- CTTTCAGGTCGATGATGTGGAA -3'

Sequencing Primer
(F):5'- AGGGAGTACTCTTACCACTGAGC -3'
(R):5'- CCTCCCAAGGGCTAGATTAAGTG -3'
Posted On2015-02-19