Incidental Mutation 'R3686:Vmn2r66'
ID269526
Institutional Source Beutler Lab
Gene Symbol Vmn2r66
Ensembl Gene ENSMUSG00000094950
Gene Namevomeronasal 2, receptor 66
SynonymsF830104D24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R3686 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location84994645-85012020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84995189 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 671 (V671A)
Ref Sequence ENSEMBL: ENSMUSP00000122645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124773]
Predicted Effect probably damaging
Transcript: ENSMUST00000124773
AA Change: V671A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: V671A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 5e-31 PFAM
Pfam:NCD3G 507 559 6e-21 PFAM
Pfam:7tm_3 589 827 3.8e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb16 T A 11: 102,269,059 D79E probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
B3galnt2 G A 13: 13,975,635 probably null Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cacna1g T C 11: 94,459,090 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdh4 T C 2: 179,780,367 S95P probably benign Het
Ceacam5 G A 7: 17,760,823 E919K possibly damaging Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Hsp90ab1 A G 17: 45,569,288 Y110H probably damaging Het
Map3k1 A G 13: 111,753,891 V1258A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Nmd3 C T 3: 69,746,762 R413C probably damaging Het
Olfr1301 G T 2: 111,754,569 V107F probably benign Het
Olfr661 A G 7: 104,688,392 I126V probably benign Het
Pgm3 G T 9: 86,559,510 P345T probably benign Het
Ptpn14 C A 1: 189,851,399 D814E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Ros1 A T 10: 52,145,816 V624E probably damaging Het
Sgo2b T C 8: 63,931,327 K212E probably benign Het
Shisa2 T A 14: 59,629,779 L160Q probably damaging Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Sycp2 T C 2: 178,374,384 T762A probably benign Het
Tiam2 A G 17: 3,421,684 K534E possibly damaging Het
Trdn A T 10: 33,468,189 D633V probably benign Het
Ttn T C 2: 76,916,989 Y4572C possibly damaging Het
Unc79 T A 12: 103,088,661 N921K probably damaging Het
Wdr86 T A 5: 24,718,341 T118S probably damaging Het
Zfp446 T A 7: 12,982,653 I517N probably damaging Het
Zfp830 G A 11: 82,765,362 E331K possibly damaging Het
Other mutations in Vmn2r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Vmn2r66 APN 7 85007091 missense probably benign
IGL01562:Vmn2r66 APN 7 85007287 missense probably benign 0.03
IGL01689:Vmn2r66 APN 7 85007825 missense probably damaging 1.00
IGL02237:Vmn2r66 APN 7 84994700 missense probably benign
IGL02415:Vmn2r66 APN 7 85006812 missense probably damaging 0.97
IGL02439:Vmn2r66 APN 7 85005247 splice site probably benign
IGL02545:Vmn2r66 APN 7 85006590 missense possibly damaging 0.50
IGL02708:Vmn2r66 APN 7 85006588 missense probably benign 0.00
IGL02794:Vmn2r66 APN 7 84995415 missense probably benign 0.00
IGL02885:Vmn2r66 APN 7 84995515 missense probably benign 0.00
IGL02975:Vmn2r66 APN 7 85006974 missense probably damaging 0.98
IGL03027:Vmn2r66 APN 7 84995569 splice site probably benign
IGL03081:Vmn2r66 APN 7 85007930 missense probably benign
PIT4131001:Vmn2r66 UTSW 7 84995093 missense probably damaging 1.00
R0098:Vmn2r66 UTSW 7 85005757 missense probably damaging 1.00
R0504:Vmn2r66 UTSW 7 85006815 missense probably damaging 0.99
R0557:Vmn2r66 UTSW 7 84994764 missense probably damaging 1.00
R0617:Vmn2r66 UTSW 7 84995276 missense probably benign 0.02
R0883:Vmn2r66 UTSW 7 85007862 missense probably benign
R1159:Vmn2r66 UTSW 7 84995405 missense probably benign 0.44
R1168:Vmn2r66 UTSW 7 85006854 missense possibly damaging 0.46
R1172:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1175:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1538:Vmn2r66 UTSW 7 84994958 missense possibly damaging 0.84
R1658:Vmn2r66 UTSW 7 85007747 missense probably benign 0.07
R1937:Vmn2r66 UTSW 7 84995136 missense probably damaging 0.99
R1989:Vmn2r66 UTSW 7 85011993 missense probably benign 0.01
R2698:Vmn2r66 UTSW 7 84995399 missense probably damaging 1.00
R2890:Vmn2r66 UTSW 7 85011819 splice site probably null
R4152:Vmn2r66 UTSW 7 85005592 missense probably benign 0.08
R4500:Vmn2r66 UTSW 7 85007954 missense probably damaging 1.00
R4618:Vmn2r66 UTSW 7 84995088 missense possibly damaging 0.62
R4656:Vmn2r66 UTSW 7 85011996 missense possibly damaging 0.87
R4668:Vmn2r66 UTSW 7 84994697 missense probably damaging 1.00
R4942:Vmn2r66 UTSW 7 85007772 missense probably damaging 1.00
R5163:Vmn2r66 UTSW 7 85006809 missense probably benign 0.01
R5223:Vmn2r66 UTSW 7 85007885 missense probably benign
R5377:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R5512:Vmn2r66 UTSW 7 85007941 missense probably damaging 1.00
R5611:Vmn2r66 UTSW 7 85005743 nonsense probably null
R5749:Vmn2r66 UTSW 7 85006771 nonsense probably null
R6131:Vmn2r66 UTSW 7 84995016 missense probably damaging 1.00
R6183:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R6509:Vmn2r66 UTSW 7 85006846 missense probably benign 0.12
R6930:Vmn2r66 UTSW 7 85012008 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCAAACAATGATGATCTGGCC -3'
(R):5'- TGTGTCTTCCTGAAACACCG -3'

Sequencing Primer
(F):5'- CAATGATGATCTGGCCATGTAGC -3'
(R):5'- GTGTCTTCCTGAAACACCGAGAAAC -3'
Posted On2015-02-19