Mutagenetix > Incidental Mutation

Incidental Mutation 'R3686:Hr'

269546

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000022096

Gene Name

lysine demethylase and nuclear receptor corepressor

Synonyms

rh-bmh, rh, N, bldy, ba

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3686 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70789652-70810988 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70795236 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 289 (N289K)

Ref Sequence

ENSEMBL: ENSMUSP00000124042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]

AlphaFold

Q61645

Predicted Effect

probably damaging
Transcript: ENSMUST00000022691
AA Change: N260K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: N260K

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159959

Predicted Effect

probably damaging
Transcript: ENSMUST00000161069
AA Change: N260K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: N260K

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161468

Predicted Effect

probably damaging
Transcript: ENSMUST00000163060
AA Change: N289K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: N289K

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Blast:JmjC	83	878	N/A	BLAST
JmjC	968	1179	5.23e-38	SMART

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb16	T	A	11: 102,159,885 (GRCm39)	D79E	probably benign	Het
Atp4a	G	A	7: 30,419,650 (GRCm39)	R671Q	probably benign	Het
B230307C23Rik	T	A	16: 97,810,199 (GRCm39)	N62K	probably benign	Het
B3galnt2	G	A	13: 14,150,220 (GRCm39)		probably null	Het
Bnip2	T	A	9: 69,906,432 (GRCm39)	Y118N	probably damaging	Het
Bptf	C	A	11: 106,965,024 (GRCm39)	R1275L	probably benign	Het
Cacna1g	T	C	11: 94,349,916 (GRCm39)		probably null	Het
Cdh15	G	A	8: 123,588,763 (GRCm39)	R279Q	probably damaging	Het
Cdh4	T	C	2: 179,422,160 (GRCm39)	S95P	probably benign	Het
Ceacam5	G	A	7: 17,494,748 (GRCm39)	E919K	possibly damaging	Het
Eftud2	T	C	11: 102,735,027 (GRCm39)	E624G	probably damaging	Het
Hsp90ab1	A	G	17: 45,880,214 (GRCm39)	Y110H	probably damaging	Het
Map3k1	A	G	13: 111,890,425 (GRCm39)	V1258A	probably damaging	Het
Naa11	A	T	5: 97,539,648 (GRCm39)	V170E	probably benign	Het
Nmd3	C	T	3: 69,654,095 (GRCm39)	R413C	probably damaging	Het
Or4k51	G	T	2: 111,584,914 (GRCm39)	V107F	probably benign	Het
Or56b2	A	G	7: 104,337,599 (GRCm39)	I126V	probably benign	Het
Pgm3	G	T	9: 86,441,563 (GRCm39)	P345T	probably benign	Het
Ptpn14	C	A	1: 189,583,596 (GRCm39)	D814E	probably damaging	Het
Rab36	G	A	10: 74,880,328 (GRCm39)	V63I	probably damaging	Het
Rap1gap2	C	A	11: 74,298,148 (GRCm39)	A491S	possibly damaging	Het
Ros1	A	T	10: 52,021,912 (GRCm39)	V624E	probably damaging	Het
Sgo2b	T	C	8: 64,384,361 (GRCm39)	K212E	probably benign	Het
Shisa2	T	A	14: 59,867,228 (GRCm39)	L160Q	probably damaging	Het
Strn4	A	G	7: 16,556,506 (GRCm39)	Y123C	probably damaging	Het
Sycp2	T	C	2: 178,016,177 (GRCm39)	T762A	probably benign	Het
Tiam2	A	G	17: 3,471,959 (GRCm39)	K534E	possibly damaging	Het
Trdn	A	T	10: 33,344,185 (GRCm39)	D633V	probably benign	Het
Ttn	T	C	2: 76,747,333 (GRCm39)	Y4572C	possibly damaging	Het
Unc79	T	A	12: 103,054,920 (GRCm39)	N921K	probably damaging	Het
Vmn2r66	A	G	7: 84,644,397 (GRCm39)	V671A	probably damaging	Het
Wdr86	T	A	5: 24,923,339 (GRCm39)	T118S	probably damaging	Het
Zfp446	T	A	7: 12,716,580 (GRCm39)	I517N	probably damaging	Het
Zfp830	G	A	11: 82,656,188 (GRCm39)	E331K	possibly damaging	Het

Other mutations in Hr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01805:Hr	APN	14	70,802,737 (GRCm39)	splice site	probably benign
IGL02020:Hr	APN	14	70,793,877 (GRCm39)	missense	probably benign	0.01
IGL02372:Hr	APN	14	70,795,790 (GRCm39)	missense	possibly damaging	0.94
IGL02380:Hr	APN	14	70,795,201 (GRCm39)	missense	probably damaging	0.98
IGL02554:Hr	APN	14	70,797,306 (GRCm39)	splice site	probably benign
IGL02949:Hr	APN	14	70,797,225 (GRCm39)	missense	possibly damaging	0.87
IGL03406:Hr	APN	14	70,800,860 (GRCm39)	critical splice donor site	probably null
angie	UTSW	14	70,805,273 (GRCm39)	missense	probably damaging	0.97
blofeld	UTSW	14	70,805,525 (GRCm39)	missense	probably damaging	1.00
general	UTSW	14	70,801,124 (GRCm39)	critical splice donor site	probably null
kaburo	UTSW	14	0 ()	unclassified
mister_clean	UTSW	14	70,797,504 (GRCm39)	critical splice donor site	probably benign
mushroom	UTSW	14	70,805,525 (GRCm39)	missense	probably damaging	1.00
prune	UTSW	14	70,808,869 (GRCm39)	missense	probably damaging	1.00
ren	UTSW	14	70,805,525 (GRCm39)	missense	probably damaging	1.00
subclinical	UTSW	14	70,799,276 (GRCm39)	missense	possibly damaging	0.89
vessel	UTSW	14	70,799,305 (GRCm39)	nonsense	probably null
yuanxiao	UTSW	14	70,808,888 (GRCm39)	missense	probably damaging	1.00
R0018:Hr	UTSW	14	70,795,717 (GRCm39)	missense	probably benign
R0038:Hr	UTSW	14	70,805,525 (GRCm39)	missense	probably damaging	1.00
R0374:Hr	UTSW	14	70,793,916 (GRCm39)	missense	probably benign	0.01
R0511:Hr	UTSW	14	70,799,352 (GRCm39)	nonsense	probably null
R0609:Hr	UTSW	14	70,797,097 (GRCm39)	missense	probably benign
R1828:Hr	UTSW	14	70,809,477 (GRCm39)	critical splice donor site	probably null
R2030:Hr	UTSW	14	70,808,888 (GRCm39)	missense	probably damaging	1.00
R2266:Hr	UTSW	14	70,795,547 (GRCm39)	missense	probably benign
R2267:Hr	UTSW	14	70,795,547 (GRCm39)	missense	probably benign
R2268:Hr	UTSW	14	70,795,547 (GRCm39)	missense	probably benign
R2377:Hr	UTSW	14	70,795,318 (GRCm39)	missense	probably damaging	1.00
R3687:Hr	UTSW	14	70,795,236 (GRCm39)	missense	probably damaging	0.98
R3754:Hr	UTSW	14	70,805,264 (GRCm39)	missense	probably damaging	1.00
R3803:Hr	UTSW	14	70,795,333 (GRCm39)	missense	probably benign	0.01
R3846:Hr	UTSW	14	70,808,893 (GRCm39)	missense	probably damaging	1.00
R3977:Hr	UTSW	14	70,801,024 (GRCm39)	missense	probably benign	0.01
R3978:Hr	UTSW	14	70,801,024 (GRCm39)	missense	probably benign	0.01
R3979:Hr	UTSW	14	70,801,024 (GRCm39)	missense	probably benign	0.01
R4528:Hr	UTSW	14	70,803,823 (GRCm39)	missense	probably damaging	1.00
R4654:Hr	UTSW	14	70,801,013 (GRCm39)	missense	probably damaging	0.99
R4834:Hr	UTSW	14	70,797,362 (GRCm39)	missense	probably damaging	0.98
R4847:Hr	UTSW	14	70,793,916 (GRCm39)	missense	probably benign	0.04
R4863:Hr	UTSW	14	70,809,412 (GRCm39)	missense	probably damaging	1.00
R5292:Hr	UTSW	14	70,809,432 (GRCm39)	missense	probably damaging	1.00
R5452:Hr	UTSW	14	70,794,067 (GRCm39)	missense	probably damaging	1.00
R5717:Hr	UTSW	14	70,803,616 (GRCm39)	missense	probably benign	0.34
R5902:Hr	UTSW	14	70,795,231 (GRCm39)	missense	probably benign	0.02
R6000:Hr	UTSW	14	70,805,273 (GRCm39)	missense	probably damaging	0.97
R6439:Hr	UTSW	14	70,799,276 (GRCm39)	missense	possibly damaging	0.89
R6823:Hr	UTSW	14	70,802,814 (GRCm39)	missense	probably damaging	0.98
R7030:Hr	UTSW	14	70,801,124 (GRCm39)	critical splice donor site	probably null
R7213:Hr	UTSW	14	70,795,790 (GRCm39)	missense	probably damaging	0.99
R7452:Hr	UTSW	14	70,808,926 (GRCm39)	missense	probably damaging	1.00
R7468:Hr	UTSW	14	70,795,652 (GRCm39)	missense	possibly damaging	0.89
R7572:Hr	UTSW	14	70,799,293 (GRCm39)	missense	possibly damaging	0.66
R7956:Hr	UTSW	14	70,797,327 (GRCm39)	missense	probably benign
R7996:Hr	UTSW	14	70,801,043 (GRCm39)	nonsense	probably null
R7997:Hr	UTSW	14	70,801,043 (GRCm39)	nonsense	probably null
R8076:Hr	UTSW	14	70,795,381 (GRCm39)	missense	probably benign	0.00
R8101:Hr	UTSW	14	70,805,282 (GRCm39)	missense	possibly damaging	0.67
R8553:Hr	UTSW	14	70,804,965 (GRCm39)	missense	probably damaging	1.00
R8749:Hr	UTSW	14	70,795,510 (GRCm39)	missense	probably damaging	1.00
R8850:Hr	UTSW	14	70,799,305 (GRCm39)	nonsense	probably null
R8949:Hr	UTSW	14	70,795,328 (GRCm39)	missense	probably benign	0.01
R9139:Hr	UTSW	14	70,795,079 (GRCm39)	missense	possibly damaging	0.65
R9236:Hr	UTSW	14	70,809,396 (GRCm39)	missense	probably damaging	1.00
R9246:Hr	UTSW	14	70,808,915 (GRCm39)	missense	probably damaging	1.00
R9327:Hr	UTSW	14	70,805,228 (GRCm39)	missense	possibly damaging	0.91
R9337:Hr	UTSW	14	70,797,324 (GRCm39)	missense	probably benign	0.00
R9487:Hr	UTSW	14	70,794,205 (GRCm39)	missense	possibly damaging	0.77
R9487:Hr	UTSW	14	70,793,877 (GRCm39)	missense	probably benign	0.01
R9700:Hr	UTSW	14	70,804,616 (GRCm39)	missense	probably benign	0.00
X0025:Hr	UTSW	14	70,804,391 (GRCm39)	splice site	probably null
X0026:Hr	UTSW	14	70,805,281 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGCTTTTACCACAAGGATCCG -3'
(R):5'- TCCTACAAGGGCCAAGATCC -3'

Sequencing Primer
(F):5'- GGATCCGAACATCCTCAGG -3'
(R):5'- CCCTCTCTGGCAGGTAGATG -3'

Posted On

2015-02-19