Incidental Mutation 'R3688:Efl1'
ID269618
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R3688 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82762970 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 856 (S856T)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: S856T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: S856T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: S856T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: S856T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,849 I687T possibly damaging Het
7420426K07Rik A T 9: 98,903,464 M61L probably benign Het
A1cf T A 19: 31,911,169 F100I probably damaging Het
Adam12 A T 7: 133,964,796 Y308* probably null Het
Adam3 T C 8: 24,703,848 T383A probably benign Het
Adcy8 T C 15: 64,871,707 T351A probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp7b T C 8: 22,004,230 H956R probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cept1 G T 3: 106,520,015 N236K probably benign Het
Col15a1 C T 4: 47,258,689 T360I probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Fat2 T C 11: 55,281,101 T2929A probably damaging Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Hdac10 C T 15: 89,123,564 probably null Het
Il17rd C A 14: 27,039,148 N15K probably null Het
Kcnt1 C T 2: 25,894,359 T258I probably damaging Het
Kif5a T G 10: 127,242,774 N334T probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Map4k4 T A 1: 39,985,171 probably null Het
Nat6 T C 9: 107,583,350 V148A possibly damaging Het
Olfr459 G T 6: 41,772,226 Y24* probably null Het
Pard3b A G 1: 62,479,569 T938A probably benign Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pfkm T A 15: 98,131,517 N697K probably benign Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Slc34a2 G A 5: 53,064,832 G289S probably benign Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Swt1 A T 1: 151,391,489 M647K probably damaging Het
Trpm5 A G 7: 143,078,456 V872A probably damaging Het
Ubqln4 T C 3: 88,563,159 S313P probably damaging Het
Vmn1r17 T A 6: 57,360,559 T225S probably damaging Het
Vmn2r75 T A 7: 86,148,421 H728L probably damaging Het
Vps33a T C 5: 123,535,211 probably null Het
Vwde T A 6: 13,186,892 R865S probably damaging Het
Zfp408 T A 2: 91,646,432 M126L probably benign Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCCTCCTTGAACGAGGGTAG -3'
(R):5'- ACTGACCTTGGTGCTGTTTATC -3'

Sequencing Primer
(F):5'- TCCTCCTTGAACGAGGGTAGAAATAC -3'
(R):5'- GACCTTGGTGCTGTTTATCACTTGC -3'
Posted On2015-02-19