Incidental Mutation 'R3689:Zap70'
ID269645
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
MMRRC Submission 040684-MU
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R3689 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36781412 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 563 (C563R)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
Predicted Effect probably damaging
Transcript: ENSMUST00000027291
AA Change: C563R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: C563R

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190128
Meta Mutation Damage Score 0.486 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A C 9: 92,352,620 N60T probably damaging Het
Adcy2 A T 13: 68,630,969 L984Q probably damaging Het
Atg16l1 T C 1: 87,785,904 V427A probably damaging Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Blm G C 7: 80,513,079 P175A possibly damaging Het
Bpifb1 A G 2: 154,209,899 D208G probably benign Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cep162 G A 9: 87,225,694 Q548* probably null Het
Chchd10 T C 10: 75,936,001 V13A probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Erich2 T C 2: 70,540,753 V445A unknown Het
Fam129a A G 1: 151,703,696 probably null Het
Fam53c A G 18: 34,770,833 D386G probably damaging Het
Fgd2 A G 17: 29,378,950 T620A probably benign Het
G930045G22Rik A T 6: 50,846,555 noncoding transcript Het
Grpel1 G A 5: 36,469,425 probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Mtss1 A G 15: 58,953,536 S272P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
N4bp1 C T 8: 86,860,556 D585N probably damaging Het
Napb T C 2: 148,703,057 probably null Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nms T C 1: 38,946,994 probably benign Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1221 T A 2: 89,112,042 I157L possibly damaging Het
Pak6 C T 2: 118,693,440 Q359* probably null Het
Pcdhb12 C T 18: 37,436,074 A91V probably benign Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Sec31a T A 5: 100,382,907 D239V probably damaging Het
Slc13a4 T C 6: 35,268,910 N600S possibly damaging Het
Smc1b T A 15: 85,117,263 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Sprr2j-ps A G 3: 92,418,983 H55R probably benign Het
Srsf9 A G 5: 115,327,328 D7G probably benign Het
Stt3a T C 9: 36,759,322 Y51C probably damaging Het
Taf5 A G 19: 47,078,785 K519E probably damaging Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tnk1 C A 11: 69,855,599 D263Y probably damaging Het
Ttc21b T A 2: 66,224,144 I714F probably benign Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Txn1 T C 4: 57,950,846 D61G probably benign Het
Ugcg T C 4: 59,211,883 V83A probably benign Het
Ulk3 T C 9: 57,593,794 V348A probably benign Het
Wdr93 A G 7: 79,771,585 T409A possibly damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Zc3h12c C T 9: 52,115,956 R721H probably benign Het
Zfp169 A G 13: 48,506,901 probably benign Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Predicted Primers PCR Primer
(F):5'- CCTTCTCCTATGGCCAGAAG -3'
(R):5'- TGTTGGGAAGCCAAGCACAG -3'

Sequencing Primer
(F):5'- GCCAGAAGCCCTACAAGGTAG -3'
(R):5'- AAGAAGCCGGGTGTGACTCTG -3'
Posted OnFeb 19, 2015