Incidental Mutation 'R3689:1700057G04Rik'
List |< first << previous [record 32 of 10171] next >> last >|
ID269677
Institutional Source Beutler Lab
Gene Symbol 1700057G04Rik
Ensembl Gene ENSMUSG00000074139
Gene NameRIKEN cDNA 1700057G04 gene
Synonyms
MMRRC Submission 040684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3689 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location92309377-92357876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92352620 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 60 (N60T)
Ref Sequence ENSEMBL: ENSMUSP00000139734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098477] [ENSMUST00000185580]
Predicted Effect probably damaging
Transcript: ENSMUST00000098477
AA Change: N136T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096077
Gene: ENSMUSG00000074139
AA Change: N136T

DomainStartEndE-ValueType
Pfam:Scramblase 1 222 6.3e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134712
Predicted Effect unknown
Transcript: ENSMUST00000135182
AA Change: N49T
Predicted Effect probably damaging
Transcript: ENSMUST00000185580
AA Change: N60T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139734
Gene: ENSMUSG00000074139
AA Change: N60T

DomainStartEndE-ValueType
Pfam:Scramblase 1 146 8.4e-57 PFAM
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,630,969 L984Q probably damaging Het
Atg16l1 T C 1: 87,785,904 V427A probably damaging Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Blm G C 7: 80,513,079 P175A possibly damaging Het
Bpifb1 A G 2: 154,209,899 D208G probably benign Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cep162 G A 9: 87,225,694 Q548* probably null Het
Chchd10 T C 10: 75,936,001 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Erich2 T C 2: 70,540,753 V419A unknown Het
Fam129a A G 1: 151,703,696 probably null Het
Fam53c A G 18: 34,770,833 D386G probably damaging Het
Fgd2 A G 17: 29,378,950 T620A probably benign Het
G930045G22Rik A T 6: 50,846,555 noncoding transcript Het
Grpel1 G A 5: 36,469,425 probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Mtss1 A G 15: 58,953,536 S272P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
N4bp1 C T 8: 86,860,556 D585N probably damaging Het
Napb T C 2: 148,703,057 probably null Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nms T C 1: 38,946,994 probably benign Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1221 T A 2: 89,112,042 I157L possibly damaging Het
Pak6 C T 2: 118,693,440 Q359* probably null Het
Pcdhb12 C T 18: 37,436,074 A91V probably benign Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Sec31a T A 5: 100,382,907 D239V probably damaging Het
Slc13a4 T C 6: 35,268,910 N600S possibly damaging Het
Smc1b T A 15: 85,117,263 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Sprr2j-ps A G 3: 92,418,983 H55R probably benign Het
Srsf9 A G 5: 115,327,328 D7G probably benign Het
Stt3a T C 9: 36,759,322 Y51C probably damaging Het
Taf5 A G 19: 47,078,785 K519E probably damaging Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tnk1 C A 11: 69,855,599 D263Y probably damaging Het
Ttc21b T A 2: 66,224,144 I714F probably benign Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Txn1 T C 4: 57,950,846 D61G probably benign Het
Ugcg T C 4: 59,211,883 V83A probably benign Het
Ulk3 T C 9: 57,593,794 V348A probably benign Het
Wdr93 A G 7: 79,771,585 T409A possibly damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zc3h12c C T 9: 52,115,956 R721H probably benign Het
Zfp169 A G 13: 48,506,901 probably benign Het
Other mutations in 1700057G04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:1700057G04Rik APN 9 92350952 nonsense probably null
IGL01627:1700057G04Rik APN 9 92347811 missense probably damaging 0.99
IGL02118:1700057G04Rik APN 9 92350958 nonsense probably null
R0815:1700057G04Rik UTSW 9 92351087 missense possibly damaging 0.87
R0863:1700057G04Rik UTSW 9 92351087 missense possibly damaging 0.87
R1400:1700057G04Rik UTSW 9 92351127 missense probably benign 0.00
R4280:1700057G04Rik UTSW 9 92343648 missense possibly damaging 0.92
R4789:1700057G04Rik UTSW 9 92351031 missense probably damaging 0.98
R4810:1700057G04Rik UTSW 9 92354630 missense probably damaging 1.00
R4880:1700057G04Rik UTSW 9 92354612 missense probably damaging 1.00
R4987:1700057G04Rik UTSW 9 92354584 missense probably damaging 1.00
R5427:1700057G04Rik UTSW 9 92352596 missense probably benign 0.43
R5602:1700057G04Rik UTSW 9 92352668 missense possibly damaging 0.88
R5702:1700057G04Rik UTSW 9 92343688 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTTATAGATTGGAGCACTGGC -3'
(R):5'- GTAAGCACTGACCTTGTATTGG -3'

Sequencing Primer
(F):5'- GGCTGTCATTCTAAGTAAATGAAGCC -3'
(R):5'- CTCCACCTAATACAGCTTTAC -3'
Posted On2015-02-19