Incidental Mutation 'R3696:Olfr1138'
ID269805
Institutional Source Beutler Lab
Gene Symbol Olfr1138
Ensembl Gene ENSMUSG00000075149
Gene Nameolfactory receptor 1138
SynonymsGA_x6K02T2Q125-49242149-49241214, MOR177-8
MMRRC Submission 040690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3696 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87736747-87739978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87738016 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 103 (T103A)
Ref Sequence ENSEMBL: ENSMUSP00000148941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099848] [ENSMUST00000214573]
Predicted Effect probably benign
Transcript: ENSMUST00000099848
AA Change: T103A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097435
Gene: ENSMUSG00000075149
AA Change: T103A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-45 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214573
AA Change: T103A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Anapc4 A G 5: 52,862,009 S562G probably null Het
Arfgef2 T A 2: 166,853,300 L531* probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cacna1s A G 1: 136,105,814 M1010V probably damaging Het
Chga A G 12: 102,561,465 E126G probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Dlat C T 9: 50,650,876 V283I possibly damaging Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ephx1 G A 1: 180,989,951 S385L probably benign Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Etl4 G A 2: 20,801,662 probably null Het
Hydin T C 8: 110,603,279 S4882P probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Itgb8 A G 12: 119,177,011 V377A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lama3 A G 18: 12,439,475 probably benign Het
Macf1 T G 4: 123,456,362 T2027P probably damaging Het
Myh13 A C 11: 67,345,044 I678L possibly damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Prm3 T C 16: 10,790,808 M28V possibly damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A T 11: 87,585,234 T212S possibly damaging Het
Trdn T A 10: 33,305,032 probably null Het
Trim2 T A 3: 84,190,851 Y390F probably benign Het
Vmn1r17 T A 6: 57,360,538 I232F possibly damaging Het
Zfp30 A T 7: 29,793,390 K356N probably damaging Het
Other mutations in Olfr1138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Olfr1138 APN 2 87737986 missense probably benign 0.01
IGL02490:Olfr1138 APN 2 87737955 missense probably damaging 1.00
IGL02730:Olfr1138 APN 2 87737641 missense probably damaging 1.00
IGL03106:Olfr1138 APN 2 87738118 missense probably benign 0.02
IGL03113:Olfr1138 APN 2 87738162 missense probably benign 0.01
R0450:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0469:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0510:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R3698:Olfr1138 UTSW 2 87738016 missense probably benign
R5149:Olfr1138 UTSW 2 87737405 missense probably benign
R5156:Olfr1138 UTSW 2 87737775 missense possibly damaging 0.95
R6245:Olfr1138 UTSW 2 87737896 missense possibly damaging 0.54
R6701:Olfr1138 UTSW 2 87737409 missense probably benign
R7170:Olfr1138 UTSW 2 87737712 missense probably damaging 0.99
R7185:Olfr1138 UTSW 2 87738145 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACAGAAACATAAGTGGAATGTC -3'
(R):5'- TTGGGAATTACCAGTAACCCTG -3'

Sequencing Primer
(F):5'- AGTGGAATGTCAATGTTGTATGTATC -3'
(R):5'- CTGCTGACAAATCTTGGAATGATC -3'
Posted On2015-03-18