Incidental Mutation 'R3696:Trim2'
ID269810
Institutional Source Beutler Lab
Gene Symbol Trim2
Ensembl Gene ENSMUSG00000027993
Gene Nametripartite motif-containing 2
Synonymsneural activity-related ring finger protein, narf
MMRRC Submission 040690-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R3696 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location84160439-84306877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84190851 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 390 (Y390F)
Ref Sequence ENSEMBL: ENSMUSP00000049902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054990] [ENSMUST00000065380] [ENSMUST00000107691] [ENSMUST00000107692] [ENSMUST00000107693] [ENSMUST00000107695] [ENSMUST00000122849] [ENSMUST00000132283] [ENSMUST00000147901]
Predicted Effect probably benign
Transcript: ENSMUST00000054990
AA Change: Y390F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000049902
Gene: ENSMUSG00000027993
AA Change: Y390F

DomainStartEndE-ValueType
RING 49 89 3.5e-9 SMART
BBOX 139 180 3.52e-14 SMART
BBC 187 313 1.7e-38 SMART
IG_FLMN 350 450 2.41e-30 SMART
Pfam:NHL 512 539 2e-8 PFAM
Pfam:NHL 559 586 1.1e-8 PFAM
Pfam:NHL 601 628 2.1e-7 PFAM
Pfam:NHL 648 675 5.8e-10 PFAM
Pfam:NHL 695 722 3.5e-12 PFAM
Pfam:NHL 739 766 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065380
AA Change: Y364F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000069922
Gene: ENSMUSG00000027993
AA Change: Y364F

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107691
AA Change: Y364F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103319
Gene: ENSMUSG00000027993
AA Change: Y364F

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107692
AA Change: Y364F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103320
Gene: ENSMUSG00000027993
AA Change: Y364F

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107693
AA Change: Y364F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103321
Gene: ENSMUSG00000027993
AA Change: Y364F

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107695
AA Change: Y381F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103323
Gene: ENSMUSG00000027993
AA Change: Y381F

DomainStartEndE-ValueType
RING 40 80 3.5e-9 SMART
BBOX 130 171 3.52e-14 SMART
BBC 178 304 1.7e-38 SMART
IG_FLMN 341 441 2.41e-30 SMART
Pfam:NHL 503 530 9.1e-8 PFAM
Pfam:NHL 550 577 7.5e-8 PFAM
Pfam:NHL 592 619 1.2e-6 PFAM
Pfam:NHL 639 666 6.3e-9 PFAM
Pfam:NHL 686 713 4.7e-12 PFAM
Pfam:NHL 730 757 5.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122849
SMART Domains Protein: ENSMUSP00000120981
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 41 81 3.5e-9 SMART
BBOX 131 172 3.52e-14 SMART
Blast:BBC 179 213 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128574
Predicted Effect probably benign
Transcript: ENSMUST00000132283
SMART Domains Protein: ENSMUSP00000118888
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
Blast:BBC 161 191 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140568
Predicted Effect probably benign
Transcript: ENSMUST00000147901
SMART Domains Protein: ENSMUSP00000121055
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156347
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit tremors, ataxia and seizures associated with neurodegeneration of Purkinje cells, deep cerebellar nuclei and retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Anapc4 A G 5: 52,862,009 S562G probably null Het
Arfgef2 T A 2: 166,853,300 L531* probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cacna1s A G 1: 136,105,814 M1010V probably damaging Het
Chga A G 12: 102,561,465 E126G probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Dlat C T 9: 50,650,876 V283I possibly damaging Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ephx1 G A 1: 180,989,951 S385L probably benign Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Etl4 G A 2: 20,801,662 probably null Het
Hydin T C 8: 110,603,279 S4882P probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Itgb8 A G 12: 119,177,011 V377A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lama3 A G 18: 12,439,475 probably benign Het
Macf1 T G 4: 123,456,362 T2027P probably damaging Het
Myh13 A C 11: 67,345,044 I678L possibly damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Prm3 T C 16: 10,790,808 M28V possibly damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A T 11: 87,585,234 T212S possibly damaging Het
Trdn T A 10: 33,305,032 probably null Het
Vmn1r17 T A 6: 57,360,538 I232F possibly damaging Het
Zfp30 A T 7: 29,793,390 K356N probably damaging Het
Other mutations in Trim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trim2 APN 3 84208289 missense probably damaging 1.00
IGL01658:Trim2 APN 3 84210285 missense probably benign 0.33
IGL02943:Trim2 APN 3 84178176 missense probably benign 0.45
PIT4142001:Trim2 UTSW 3 84190857 missense probably benign 0.00
R0149:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R0158:Trim2 UTSW 3 84210169 splice site probably benign
R0361:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R1270:Trim2 UTSW 3 84167677 missense probably damaging 1.00
R1651:Trim2 UTSW 3 84167650 critical splice donor site probably null
R1756:Trim2 UTSW 3 84190800 missense possibly damaging 0.52
R1938:Trim2 UTSW 3 84177792 missense possibly damaging 0.94
R2046:Trim2 UTSW 3 84208289 missense probably damaging 1.00
R2192:Trim2 UTSW 3 84190918 nonsense probably null
R4981:Trim2 UTSW 3 84177735 missense probably damaging 1.00
R5389:Trim2 UTSW 3 84167653 missense probably null 0.60
R5735:Trim2 UTSW 3 84167722 missense probably damaging 1.00
R7228:Trim2 UTSW 3 84192181 missense probably benign 0.01
R7297:Trim2 UTSW 3 84210233 missense probably damaging 1.00
X0065:Trim2 UTSW 3 84165173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTGACTCGTCGCTTCACG -3'
(R):5'- ATTTTATCGTGGAAACGGAGGGAC -3'

Sequencing Primer
(F):5'- CAGAGCGGATGACCTTGAGC -3'
(R):5'- CTGAAGAAGTCTATCCACAACCTGGG -3'
Posted On2015-03-18