Incidental Mutation 'R3696:Anapc4'
ID 269815
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Name anaphase promoting complex subunit 4
Synonyms D5Ertd249e, 2610306D21Rik, APC4
MMRRC Submission 040690-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3696 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 52991477-53024076 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53019351 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 562 (S562G)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
AlphaFold Q91W96
Predicted Effect probably null
Transcript: ENSMUST00000031072
AA Change: S562G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: S562G

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142035
Predicted Effect probably benign
Transcript: ENSMUST00000144574
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154980
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,369,562 (GRCm39) H371R possibly damaging Het
Arfgef2 T A 2: 166,695,220 (GRCm39) L531* probably null Het
Bckdk C A 7: 127,504,590 (GRCm39) R105S probably damaging Het
Cacna1s A G 1: 136,033,552 (GRCm39) M1010V probably damaging Het
Chga A G 12: 102,527,724 (GRCm39) E126G probably damaging Het
Ckap5 C A 2: 91,450,511 (GRCm39) T2014K probably benign Het
Dlat C T 9: 50,562,176 (GRCm39) V283I possibly damaging Het
Emc1 T G 4: 139,092,697 (GRCm39) S546A possibly damaging Het
Ephx1 G A 1: 180,817,516 (GRCm39) S385L probably benign Het
Ermard T C 17: 15,273,638 (GRCm39) S408P probably benign Het
Etl4 G A 2: 20,806,473 (GRCm39) probably null Het
Hydin T C 8: 111,329,911 (GRCm39) S4882P probably damaging Het
Il12a TCAC TC 3: 68,605,320 (GRCm39) probably null Het
Il6st T G 13: 112,640,916 (GRCm39) D897E probably benign Het
Ipo5 A C 14: 121,159,574 (GRCm39) K134T probably benign Het
Itgb8 A G 12: 119,140,746 (GRCm39) V377A probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Lama3 A G 18: 12,572,532 (GRCm39) probably benign Het
Macf1 T G 4: 123,350,155 (GRCm39) T2027P probably damaging Het
Myh13 A C 11: 67,235,870 (GRCm39) I678L possibly damaging Het
Nfu1 A G 6: 86,992,634 (GRCm39) T83A probably damaging Het
Nid1 G A 13: 13,661,344 (GRCm39) C748Y probably damaging Het
Or1af1 C T 2: 37,110,188 (GRCm39) P229L probably damaging Het
Or5w15 T C 2: 87,568,360 (GRCm39) T103A probably benign Het
Prm3 T C 16: 10,608,672 (GRCm39) M28V possibly damaging Het
Rgs22 C T 15: 36,100,038 (GRCm39) V226I probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Septin4 A T 11: 87,476,060 (GRCm39) T212S possibly damaging Het
Trdn T A 10: 33,181,028 (GRCm39) probably null Het
Trim2 T A 3: 84,098,158 (GRCm39) Y390F probably benign Het
Vmn1r17 T A 6: 57,337,523 (GRCm39) I232F possibly damaging Het
Zfp30 A T 7: 29,492,815 (GRCm39) K356N probably damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 53,014,553 (GRCm39) missense probably damaging 0.98
IGL01066:Anapc4 APN 5 53,014,551 (GRCm39) missense probably benign 0.08
IGL01109:Anapc4 APN 5 53,005,970 (GRCm39) missense probably damaging 1.00
IGL01657:Anapc4 APN 5 53,021,968 (GRCm39) nonsense probably null
IGL02692:Anapc4 APN 5 53,021,871 (GRCm39) missense probably damaging 0.98
IGL02734:Anapc4 APN 5 53,018,633 (GRCm39) missense probably benign 0.04
IGL03089:Anapc4 APN 5 53,023,740 (GRCm39) missense probably benign 0.32
IGL03096:Anapc4 APN 5 53,023,271 (GRCm39) missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 53,021,868 (GRCm39) missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52,997,075 (GRCm39) missense probably benign 0.00
R0331:Anapc4 UTSW 5 53,012,984 (GRCm39) splice site probably benign
R0511:Anapc4 UTSW 5 52,999,359 (GRCm39) unclassified probably benign
R0624:Anapc4 UTSW 5 53,002,761 (GRCm39) splice site probably benign
R0919:Anapc4 UTSW 5 53,012,979 (GRCm39) missense probably benign 0.18
R1935:Anapc4 UTSW 5 52,997,010 (GRCm39) missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52,997,010 (GRCm39) missense probably damaging 0.99
R1942:Anapc4 UTSW 5 53,004,056 (GRCm39) missense probably benign 0.30
R1953:Anapc4 UTSW 5 52,997,030 (GRCm39) missense probably damaging 1.00
R1954:Anapc4 UTSW 5 53,003,967 (GRCm39) intron probably benign
R2341:Anapc4 UTSW 5 52,999,279 (GRCm39) unclassified probably benign
R4506:Anapc4 UTSW 5 52,993,072 (GRCm39) missense possibly damaging 0.79
R4596:Anapc4 UTSW 5 52,999,060 (GRCm39) missense probably benign 0.00
R5234:Anapc4 UTSW 5 53,006,118 (GRCm39) missense probably damaging 1.00
R5256:Anapc4 UTSW 5 53,020,936 (GRCm39) missense probably benign
R5310:Anapc4 UTSW 5 53,016,501 (GRCm39) missense probably benign 0.00
R5401:Anapc4 UTSW 5 53,020,991 (GRCm39) missense probably benign 0.01
R5409:Anapc4 UTSW 5 53,005,941 (GRCm39) missense probably damaging 0.98
R5525:Anapc4 UTSW 5 53,014,151 (GRCm39) missense probably damaging 1.00
R5575:Anapc4 UTSW 5 53,013,213 (GRCm39) missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52,999,076 (GRCm39) nonsense probably null
R5695:Anapc4 UTSW 5 53,019,581 (GRCm39) missense probably benign 0.00
R5955:Anapc4 UTSW 5 53,023,288 (GRCm39) missense probably benign 0.01
R5974:Anapc4 UTSW 5 53,002,742 (GRCm39) missense probably damaging 1.00
R6458:Anapc4 UTSW 5 53,021,895 (GRCm39) missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 53,000,898 (GRCm39) missense probably damaging 0.98
R6633:Anapc4 UTSW 5 53,023,288 (GRCm39) missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 53,006,170 (GRCm39) missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52,993,093 (GRCm39) missense possibly damaging 0.89
R7067:Anapc4 UTSW 5 53,019,577 (GRCm39) missense probably benign
R7327:Anapc4 UTSW 5 53,002,672 (GRCm39) missense probably damaging 0.99
R7442:Anapc4 UTSW 5 53,014,543 (GRCm39) missense probably benign 0.08
R7837:Anapc4 UTSW 5 53,016,550 (GRCm39) critical splice donor site probably null
R8382:Anapc4 UTSW 5 53,016,277 (GRCm39) splice site probably null
R8840:Anapc4 UTSW 5 53,016,473 (GRCm39) missense probably damaging 0.98
R8914:Anapc4 UTSW 5 53,000,843 (GRCm39) nonsense probably null
R8972:Anapc4 UTSW 5 53,007,884 (GRCm39) missense possibly damaging 0.88
R9037:Anapc4 UTSW 5 53,021,843 (GRCm39) missense probably benign 0.16
R9211:Anapc4 UTSW 5 53,007,994 (GRCm39) missense possibly damaging 0.74
R9269:Anapc4 UTSW 5 53,018,620 (GRCm39) missense possibly damaging 0.92
R9294:Anapc4 UTSW 5 53,021,867 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GGGTGTGATCAGGGTCAAAC -3'
(R):5'- ATCAGTATGTCTCCTTAAGATGCAC -3'

Sequencing Primer
(F):5'- GGTCAAACCCAGCATTTTGC -3'
(R):5'- TATGAAGCTGCCTAGGGTAAACAC -3'
Posted On 2015-03-18