Incidental Mutation 'R3696:Nfu1'
ID269818
Institutional Source Beutler Lab
Gene Symbol Nfu1
Ensembl Gene ENSMUSG00000029993
Gene NameNFU1 iron-sulfur cluster scaffold
SynonymsCGI-33, 0610006G17Rik, Hirip5
MMRRC Submission 040690-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R3696 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87009236-87028461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87015652 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 83 (T83A)
Ref Sequence ENSEMBL: ENSMUSP00000113637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032060] [ENSMUST00000117583] [ENSMUST00000120240] [ENSMUST00000144776]
Predicted Effect probably damaging
Transcript: ENSMUST00000032060
AA Change: T83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032060
Gene: ENSMUSG00000029993
AA Change: T83A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Nfu_N 59 146 1.91e-48 SMART
low complexity region 147 166 N/A INTRINSIC
Pfam:NifU 174 240 3.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117583
AA Change: T83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113332
Gene: ENSMUSG00000029993
AA Change: T83A

DomainStartEndE-ValueType
Nfu_N 3 90 1.91e-48 SMART
low complexity region 95 112 N/A INTRINSIC
Pfam:NifU 117 185 2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120240
AA Change: T83A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113637
Gene: ENSMUSG00000029993
AA Change: T83A

DomainStartEndE-ValueType
Nfu_N 3 90 1.91e-48 SMART
low complexity region 91 110 N/A INTRINSIC
Pfam:NifU 118 186 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140343
Predicted Effect possibly damaging
Transcript: ENSMUST00000144776
AA Change: T83A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121746
Gene: ENSMUSG00000029993
AA Change: T83A

DomainStartEndE-ValueType
Nfu_N 3 163 7.18e-21 SMART
low complexity region 164 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205018
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to mitochondria and plays a critical role in iron-sulfur cluster biogenesis. The encoded protein assembles and transfers 4Fe-4S clusters to target apoproteins including succinate dehydrogenase and lipoic acid synthase. Mutations in this gene are a cause of multiple mitochondrial dysfunctions syndrome-1, and pseudogenes of this gene are located on the short arms of chromosomes 1 and 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Anapc4 A G 5: 52,862,009 S562G probably null Het
Arfgef2 T A 2: 166,853,300 L531* probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cacna1s A G 1: 136,105,814 M1010V probably damaging Het
Chga A G 12: 102,561,465 E126G probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Dlat C T 9: 50,650,876 V283I possibly damaging Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ephx1 G A 1: 180,989,951 S385L probably benign Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Etl4 G A 2: 20,801,662 probably null Het
Hydin T C 8: 110,603,279 S4882P probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Itgb8 A G 12: 119,177,011 V377A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lama3 A G 18: 12,439,475 probably benign Het
Macf1 T G 4: 123,456,362 T2027P probably damaging Het
Myh13 A C 11: 67,345,044 I678L possibly damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Prm3 T C 16: 10,790,808 M28V possibly damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A T 11: 87,585,234 T212S possibly damaging Het
Trdn T A 10: 33,305,032 probably null Het
Trim2 T A 3: 84,190,851 Y390F probably benign Het
Vmn1r17 T A 6: 57,360,538 I232F possibly damaging Het
Zfp30 A T 7: 29,793,390 K356N probably damaging Het
Other mutations in Nfu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nfu1 APN 6 87015595 missense probably damaging 1.00
IGL00467:Nfu1 APN 6 87020773 missense possibly damaging 0.91
IGL00676:Nfu1 APN 6 87015599 missense probably damaging 1.00
IGL01798:Nfu1 APN 6 87015623 missense probably damaging 1.00
R0583:Nfu1 UTSW 6 87009952 missense probably benign 0.01
R1584:Nfu1 UTSW 6 87020809 missense probably damaging 0.99
R3698:Nfu1 UTSW 6 87015652 missense probably damaging 1.00
R4659:Nfu1 UTSW 6 87019426 missense probably damaging 0.98
R5623:Nfu1 UTSW 6 87016206 small deletion probably benign
R5679:Nfu1 UTSW 6 87019397 missense probably damaging 1.00
R5823:Nfu1 UTSW 6 87025559 missense probably damaging 0.98
R6898:Nfu1 UTSW 6 87017052 intron probably null
R7002:Nfu1 UTSW 6 87016272 missense probably benign 0.00
R7122:Nfu1 UTSW 6 87009881 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGATGGTTTCCTCAACGCTG -3'
(R):5'- ACTGTCAAATACACTCCTGAGG -3'

Sequencing Primer
(F):5'- TCAACGCTGCTGGCACATG -3'
(R):5'- CCTGCCCACAAACTGTG -3'
Posted On2015-03-18