Incidental Mutation 'R3696:Chga'
ID269831
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
MMRRC Submission 040690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3696 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102561465 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 126 (E126G)
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably damaging
Transcript: ENSMUST00000021610
AA Change: E126G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194
AA Change: E126G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223100
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Anapc4 A G 5: 52,862,009 S562G probably null Het
Arfgef2 T A 2: 166,853,300 L531* probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cacna1s A G 1: 136,105,814 M1010V probably damaging Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Dlat C T 9: 50,650,876 V283I possibly damaging Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Ephx1 G A 1: 180,989,951 S385L probably benign Het
Ermard T C 17: 15,053,376 S408P probably benign Het
Etl4 G A 2: 20,801,662 probably null Het
Hydin T C 8: 110,603,279 S4882P probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Itgb8 A G 12: 119,177,011 V377A probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lama3 A G 18: 12,439,475 probably benign Het
Macf1 T G 4: 123,456,362 T2027P probably damaging Het
Myh13 A C 11: 67,345,044 I678L possibly damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Prm3 T C 16: 10,790,808 M28V possibly damaging Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A T 11: 87,585,234 T212S possibly damaging Het
Trdn T A 10: 33,305,032 probably null Het
Trim2 T A 3: 84,190,851 Y390F probably benign Het
Vmn1r17 T A 6: 57,360,538 I232F possibly damaging Het
Zfp30 A T 7: 29,793,390 K356N probably damaging Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTATGTCAGGTCCACATGG -3'
(R):5'- TCTCCATAGTGTCCCTGGAG -3'

Sequencing Primer
(F):5'- GGTCCACATGGAACCTTCC -3'
(R):5'- GCGTCTGCAAACACAAATGG -3'
Posted On2015-03-18